Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DYNC2LI1 cdna clone

DYNC2LI1 cDNA Clone

Gene Names
DYNC2LI1; LIC3; D2LIC; CGI-60; SRTD15
Synonyms
DYNC2LI1; DYNC2LI1 cDNA Clone; DYNC2LI1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccagtgaaactctctgggaaattgcaaaagctgaagtggaaaaaaggggaattaatggaagtgaaggtgatggagctgaaattgcagaaaaatttgttttcttcattggcagtaaaaatgggggaaagactactattattctaaggtgtcttgacagagatgaaccatcaaaaccaaccttagctttggaatatacatatggaagaagagcaaaagggcacaacacaccaaaagatatcgctcacttttgggaactcggtggaggaacctctttattggacttaatcagcatacccatcacaggtgacaccttacggacgttttctcttgttctcgttctggatctttcaaaacctaatgatctctggcccaccatggaaaatctcttgcaagccacaaaaagccatgtagacaaagtgataatgaaactgggaaagacaaatgctaaagcagtttctgaaatgagacagaagatctggaataatatgccgaaggatcatcctgtgagttgctgtttgggattattactggaatccttagtcccatttatagttaatgataacatcacaaacaacttctttagatttttatgcatgacttga
Sequence Length
606
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,997 Da
NCBI Official Full Name
Homo sapiens dynein, cytoplasmic 2, light intermediate chain 1, mRNA
NCBI Official Synonym Full Names
dynein cytoplasmic 2 light intermediate chain 1
NCBI Official Symbol
DYNC2LI1
NCBI Official Synonym Symbols
LIC3; D2LIC; CGI-60; SRTD15
NCBI Protein Information
cytoplasmic dynein 2 light intermediate chain 1
UniProt Protein Name
Cytoplasmic dynein 2 light intermediate chain 1
Protein Family
UniProt Gene Name
DYNC2LI1
UniProt Synonym Gene Names
D2LIC; LIC3; Dynein 2 light intermediate chain
UniProt Entry Name
DC2L1_HUMAN

Uniprot Description

DYNC2LI1: May function as a motor for intraflagellar retrograde transport. Functions in cilia biogenesis. Belongs to the dynein light intermediate chain family. 5 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 2p25.1-p24.1

Cellular Component: apical part of cell; axonemal dynein complex; axoneme; cytoplasmic microtubule; cytosol; motile primary cilium

Molecular Function: dynein heavy chain binding; protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; cilium biogenesis; ER to Golgi vesicle-mediated transport

Research Articles on DYNC2LI1

Similar Products

Product Notes

The DYNC2LI1 dync2li1 (Catalog #AAA1273089) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccagtg aaactctctg ggaaattgca aaagctgaag tggaaaaaag gggaattaat ggaagtgaag gtgatggagc tgaaattgca gaaaaatttg ttttcttcat tggcagtaaa aatgggggaa agactactat tattctaagg tgtcttgaca gagatgaacc atcaaaacca accttagctt tggaatatac atatggaaga agagcaaaag ggcacaacac accaaaagat atcgctcact tttgggaact cggtggagga acctctttat tggacttaat cagcataccc atcacaggtg acaccttacg gacgttttct cttgttctcg ttctggatct ttcaaaacct aatgatctct ggcccaccat ggaaaatctc ttgcaagcca caaaaagcca tgtagacaaa gtgataatga aactgggaaa gacaaatgct aaagcagttt ctgaaatgag acagaagatc tggaataata tgccgaagga tcatcctgtg agttgctgtt tgggattatt actggaatcc ttagtcccat ttatagttaa tgataacatc acaaacaact tctttagatt tttatgcatg acttga. It is sometimes possible for the material contained within the vial of "DYNC2LI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.