Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DUS3L cdna clone

DUS3L cDNA Clone

Gene Names
DUS3L; DUS3
Synonyms
DUS3L; DUS3L cDNA Clone; DUS3L cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagggaacggcggaggctcctctagagaatggtggtggtggcgactcgggagccggagctttggaacgaggagtggcgcccattaagcgtcaatacctcaccaccaaggagcagtttcaccaattcctggaagccaaagggcaggagaagacttgccgggaaaccgaggtaggagaccctgctggcaatgagctggctgagcctgaggctaagcggatccgactggaggatggacagacggcggacgggcagacggaggaggcagcagagcccggggagcagctacagactcagaagagggcccggggacaaaacaagggccggccccatgtgaagcccacgaactacgacaagaacaggctgtgtccctccctaatccaggagtcggctgctaagtgtttcttcggtgatcgctgccgctttctgcacgacgtggggcgctacctggagaccaagccggccgacctgggcccccgctgcgtgctcttcgagaccttcggccggtgcccctacggcgtgacctgccgcttcgctggggcccacctggggcccgagggacagaacctggtgcaggaggagttggcggcccgcgggacccagcccccgtccatccgcaacggcctggacaaagccctgcagcagcagctgcggaagcgcgaggtccgcttcgagcgagctgagcaggccctgcgccggttcagccagggccccacacccgctgccgctgtccccgagggcacggcagccgagggcgctcccaggcaggaaaactgtggtgcccagcaggtccccgcagggccgggcactagcacccctcccagcagccccgtgcggacctgcgggcccctgacggatgaggacgtggtcaggctgcggccctgtgagaagaagcggctggacatccgtggcaaactttacctggcccccctcaccacgtgtgggaacctgcccttccgacggatctgcaagcgcttcggggcggatgtgacatgtggagagatggccgtctgcaccaacctgctgcagggccagatgtccgagtgggccctactcaaacgccaccagtgtgaggacatctttggcgtccagctggagggcgccttccccgacaccatgaccaagtgtgccgagctgctgagccgcaccgtggaggtggactttgtggacatcaacgtcggctgccccatcgacctcgtgtacaagaagggtgggggctgtgccctcatgaatcgctccaccaagttccagcagatcgtccgtggcatgaaccaggtgctggatgtgccgctgactgtgaagatccgcacaggcgtccaggagcgtgtgaacctggcgcaccgcctgctgcccgagctgcgggactggggcgtggcactcgtcacgctccacggccgctctcgggagcagcgctacaccaagctagctgactggcagtacatcgaggagtgcgtgcaggccgccagccccatgcccctgttcggaaatggggacatcttgtcatttgaggatgccaaccgcgccatgcagactggtgtcaccgggatcatgattgcccgtggcgccctgctcaagccgtggctcttcacggagatcaaggagcagcggcactgggacatctcgtcgtccgagcgcctggacatcctgcgggacttcaccaactacggcctggagcactggggctcggacacgcagggcgtggagaagacccggcgctttctgctcgagtggctgtccttcctgtgccggtacgtgcccgtggggctgctggagcggctcccacagaggatcaacgagcggccgccctactacctgggccgcgactacctggagacgctgatggccagccagaaggcagccgactggatccgcatcagcgagatgctccttgggccagtgccccccagcttcgccttcttgccgaagcacaaggccaacgcgtacaagtag
Sequence Length
1953
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,106 Da
NCBI Official Full Name
Homo sapiens dihydrouridine synthase 3-like (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
dihydrouridine synthase 3 like
NCBI Official Symbol
DUS3L
NCBI Official Synonym Symbols
DUS3
NCBI Protein Information
tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like
UniProt Protein Name
tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like
UniProt Gene Name
DUS3L
UniProt Entry Name
DUS3L_HUMAN

Uniprot Description

DUS3L: Catalyzes the synthesis of dihydrouridine, a modified base found in the D-loop of most tRNAs. Belongs to the dus family. Dus3 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 1.3.1.-; Oxidoreductase; EC 1.-.-.-

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cytosol

Molecular Function: tRNA dihydrouridine synthase activity

Similar Products

Product Notes

The DUS3L dus3l (Catalog #AAA1265761) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagg gaacggcgga ggctcctcta gagaatggtg gtggtggcga ctcgggagcc ggagctttgg aacgaggagt ggcgcccatt aagcgtcaat acctcaccac caaggagcag tttcaccaat tcctggaagc caaagggcag gagaagactt gccgggaaac cgaggtagga gaccctgctg gcaatgagct ggctgagcct gaggctaagc ggatccgact ggaggatgga cagacggcgg acgggcagac ggaggaggca gcagagcccg gggagcagct acagactcag aagagggccc ggggacaaaa caagggccgg ccccatgtga agcccacgaa ctacgacaag aacaggctgt gtccctccct aatccaggag tcggctgcta agtgtttctt cggtgatcgc tgccgctttc tgcacgacgt ggggcgctac ctggagacca agccggccga cctgggcccc cgctgcgtgc tcttcgagac cttcggccgg tgcccctacg gcgtgacctg ccgcttcgct ggggcccacc tggggcccga gggacagaac ctggtgcagg aggagttggc ggcccgcggg acccagcccc cgtccatccg caacggcctg gacaaagccc tgcagcagca gctgcggaag cgcgaggtcc gcttcgagcg agctgagcag gccctgcgcc ggttcagcca gggccccaca cccgctgccg ctgtccccga gggcacggca gccgagggcg ctcccaggca ggaaaactgt ggtgcccagc aggtccccgc agggccgggc actagcaccc ctcccagcag ccccgtgcgg acctgcgggc ccctgacgga tgaggacgtg gtcaggctgc ggccctgtga gaagaagcgg ctggacatcc gtggcaaact ttacctggcc cccctcacca cgtgtgggaa cctgcccttc cgacggatct gcaagcgctt cggggcggat gtgacatgtg gagagatggc cgtctgcacc aacctgctgc agggccagat gtccgagtgg gccctactca aacgccacca gtgtgaggac atctttggcg tccagctgga gggcgccttc cccgacacca tgaccaagtg tgccgagctg ctgagccgca ccgtggaggt ggactttgtg gacatcaacg tcggctgccc catcgacctc gtgtacaaga agggtggggg ctgtgccctc atgaatcgct ccaccaagtt ccagcagatc gtccgtggca tgaaccaggt gctggatgtg ccgctgactg tgaagatccg cacaggcgtc caggagcgtg tgaacctggc gcaccgcctg ctgcccgagc tgcgggactg gggcgtggca ctcgtcacgc tccacggccg ctctcgggag cagcgctaca ccaagctagc tgactggcag tacatcgagg agtgcgtgca ggccgccagc cccatgcccc tgttcggaaa tggggacatc ttgtcatttg aggatgccaa ccgcgccatg cagactggtg tcaccgggat catgattgcc cgtggcgccc tgctcaagcc gtggctcttc acggagatca aggagcagcg gcactgggac atctcgtcgt ccgagcgcct ggacatcctg cgggacttca ccaactacgg cctggagcac tggggctcgg acacgcaggg cgtggagaag acccggcgct ttctgctcga gtggctgtcc ttcctgtgcc ggtacgtgcc cgtggggctg ctggagcggc tcccacagag gatcaacgag cggccgccct actacctggg ccgcgactac ctggagacgc tgatggccag ccagaaggca gccgactgga tccgcatcag cgagatgctc cttgggccag tgccccccag cttcgccttc ttgccgaagc acaaggccaa cgcgtacaag tag. It is sometimes possible for the material contained within the vial of "DUS3L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.