DTX2 cdna clone
DTX2 cDNA Clone
Gene Names
DTX2; RNF58
Synonyms
DTX2; DTX2 cDNA Clone; DTX2 cdna clone
Sequence
atggccatggccccaagcccttccctggtgcaggtgtacaccagccccgcggctgtggccgtgtgggaatggcaggacgggctgggcacctggcacccctacagtgccaccgtctgcagcttcatcgagcagcagtttgtccagcagaagggccaacgttttgggcttgggagcctggcccacagcatccccttgggccaggcagacccctcgctggccccttacattattgacctccccagctggacccagttccgccaggacaccggcaccatgcgggctgtgcggagacacctgttcccccagcactcagcccctggccgaggtgtcgtctgggagtggctgagcgacgatggctcctggactgcctatgaagccagcgtctgtgactatctggagcagcaggtggccaggggcaaccagctcgtggacttggcgcccctggggtacaactacactgtcaactacaccacccacacgcagaccaacaagacttccagcttttgccgcagcgtgcggcgccaagcagggccgccttacccggtgaccaccatcatcgctccgccgggccacacaggcgtcgcctgctcttgccaccagtgcctcagtggcagcagaactggccccgtgtcaggccgctaccgccactccatgaccaacctccctgcataccccgtcccccagcaccccccacacaggaccgcttctgtgtttgggacccaccaggcctttgcaccgtacaacaaaccctcactctccggggcccggtctgcgcccaggctgaacaccaccaacgcctggggcgcagctcctccttccctggggagccagcccctctaccgctccagcctctcccacctgggaccgcagcacctgcccccaggatcctccacctccggtgcagtcagtgcctccctccccagcggtccctcaagcagcccagggagcgtccctgccactgtgcccatgcagatgccaaagcccagcagagtccagcaggcgctcgcaggcatgacgagtgttctgatgtcagccattggactccctgtgtgtcttagccgcgcaccccagcccaccagccctcccgcctcccgtctggcttccaaaagtcacggctcagttaagagattgaggaaaatgtccgtgaaagaagcgaccccgaagccagagccagagccagagcaggtcataaaaaactacacggaagagctgaaagtgcccccagatgaggactgcatcatctgcatggagaagctgtccacagcgtctggatacagcgatgtgactgacagcaaggcaatcgggtccctagctgtgggccacctcaccaagtgcagccatgccttccacctgctgtgcctcctggccatgtactgcaacggcaataaggatggaagtctgcagtgtccctcctgcaaaaccatctatggagagaagacggggacccagccccagggaaagatggaggtattacggttccagatgtcgctccccggccacgaggactgcgggaccatcctcatagtttacagcattccccatggtatccagggccctgagcaccccaatcccggaaagccgttcactgccagagggtttccccgccagtgctaccttccagacaacgcccagggccgcaaggtcctagagctcctgaaggtggcctggaagaggcggctcatcttcacagtgggcacgtccagcaccacgggtgagacggacaccgtggtatggaacgagatccaccacaagacagagatggaccgcaacattacgggccacggctatcccgaccccaactacctgcagaacgtgctggctgagctggctgcccagggggtgaccgaggactgcctggagcagcagtga
Sequence Length
1869
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
62,344 Da
NCBI Official Full Name
Homo sapiens deltex homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
deltex E3 ubiquitin ligase 2
NCBI Official Symbol
DTX2
NCBI Official Synonym Symbols
RNF58
NCBI Protein Information
probable E3 ubiquitin-protein ligase DTX2
UniProt Protein Name
Probable E3 ubiquitin-protein ligase DTX2
Protein Family
UniProt Gene Name
DTX2
UniProt Synonym Gene Names
KIAA1528; RNF58; Deltex2; hDTX2
UniProt Entry Name
DTX2_HUMAN
NCBI Description
DTX2 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Uniprot Description
DTX2: Regulator of Notch signaling, a signaling pathway involved in cell-cell communications that regulates a broad spectrum of cell-fate determinations. Probably acts both as a positive and negative regulator of Notch, depending on the developmental and cell context. Mediates the antineural activity of Notch, possibly by inhibiting the transcriptional activation mediated by MATCH1. Functions as an ubiquitin ligase protein in vitro, suggesting that it may regulate the Notch pathway via some ubiquitin ligase activity. Homodimer. May form a heterodimer with other members of the Deltex family. Interacts with NOTCH1. Belongs to the Deltex family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription, coactivator/corepressor; Ubiquitin ligase; Ligase; EC 6.3.2.-; Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 7q11.23
Cellular Component: nuclear membrane; nucleoplasm
Molecular Function: protein binding
Research Articles on DTX2
Similar Products
Product Notes
The DTX2 dtx2 (Catalog #AAA1269603) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccatgg ccccaagccc ttccctggtg caggtgtaca ccagccccgc ggctgtggcc gtgtgggaat ggcaggacgg gctgggcacc tggcacccct acagtgccac cgtctgcagc ttcatcgagc agcagtttgt ccagcagaag ggccaacgtt ttgggcttgg gagcctggcc cacagcatcc ccttgggcca ggcagacccc tcgctggccc cttacattat tgacctcccc agctggaccc agttccgcca ggacaccggc accatgcggg ctgtgcggag acacctgttc ccccagcact cagcccctgg ccgaggtgtc gtctgggagt ggctgagcga cgatggctcc tggactgcct atgaagccag cgtctgtgac tatctggagc agcaggtggc caggggcaac cagctcgtgg acttggcgcc cctggggtac aactacactg tcaactacac cacccacacg cagaccaaca agacttccag cttttgccgc agcgtgcggc gccaagcagg gccgccttac ccggtgacca ccatcatcgc tccgccgggc cacacaggcg tcgcctgctc ttgccaccag tgcctcagtg gcagcagaac tggccccgtg tcaggccgct accgccactc catgaccaac ctccctgcat accccgtccc ccagcacccc ccacacagga ccgcttctgt gtttgggacc caccaggcct ttgcaccgta caacaaaccc tcactctccg gggcccggtc tgcgcccagg ctgaacacca ccaacgcctg gggcgcagct cctccttccc tggggagcca gcccctctac cgctccagcc tctcccacct gggaccgcag cacctgcccc caggatcctc cacctccggt gcagtcagtg cctccctccc cagcggtccc tcaagcagcc cagggagcgt ccctgccact gtgcccatgc agatgccaaa gcccagcaga gtccagcagg cgctcgcagg catgacgagt gttctgatgt cagccattgg actccctgtg tgtcttagcc gcgcacccca gcccaccagc cctcccgcct cccgtctggc ttccaaaagt cacggctcag ttaagagatt gaggaaaatg tccgtgaaag aagcgacccc gaagccagag ccagagccag agcaggtcat aaaaaactac acggaagagc tgaaagtgcc cccagatgag gactgcatca tctgcatgga gaagctgtcc acagcgtctg gatacagcga tgtgactgac agcaaggcaa tcgggtccct agctgtgggc cacctcacca agtgcagcca tgccttccac ctgctgtgcc tcctggccat gtactgcaac ggcaataagg atggaagtct gcagtgtccc tcctgcaaaa ccatctatgg agagaagacg gggacccagc cccagggaaa gatggaggta ttacggttcc agatgtcgct ccccggccac gaggactgcg ggaccatcct catagtttac agcattcccc atggtatcca gggccctgag caccccaatc ccggaaagcc gttcactgcc agagggtttc cccgccagtg ctaccttcca gacaacgccc agggccgcaa ggtcctagag ctcctgaagg tggcctggaa gaggcggctc atcttcacag tgggcacgtc cagcaccacg ggtgagacgg acaccgtggt atggaacgag atccaccaca agacagagat ggaccgcaac attacgggcc acggctatcc cgaccccaac tacctgcaga acgtgctggc tgagctggct gcccaggggg tgaccgagga ctgcctggag cagcagtga. It is sometimes possible for the material contained within the vial of "DTX2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
