DPP10 cdna clone
DPP10 cDNA Clone
Gene Names
DPP10; DPL2; DPPY; DPRP3; DPRP-3
Synonyms
DPP10; DPP10 cDNA Clone; DPP10 cdna clone
Sequence
atgaaccaaactgccagcgtgtcccatcacatcaagtgtcaaccctcaaaaacaatcaaggaactgggaagtaacagccctccacagagaaactggaagggaattgctattgctctgctggtgattttagttgtatgctcactcatcactatgtcagtcatcctcttaaccccagatgaactcacaaattcgtcagaaaccagattgtctttggaagacctctttaggaaagactttgtgcttcacgatccagaggctcggtggatcaatgatacagatgtggtgtataaaagcgagaatggacatgtcattaaactgaatatagaaacaaatgctaccacattattattggaaaacacaacttttgtaaccttcaaagcatcaagacattcagtttcaccagatttaaaatatgtccttctggcatatgatgtcaaacagatttttcattattcatatactgcttcatatgtgatttacaacatacacactagggaagtttgggagttaaatcctccagaagtagaggactccgtcttgcagtacgcggcctggggtgtccaagggcagcagctgatttatatttttgaaaataatatctactatcaacctgatataaagagcagttcattgcgactgacatcttctggaaaagaagaaataatttttaatgggattgctgactggttatatgaagaggaactcctgcattctcacatcgcccactggtggtcaccagatggagaaagacttgccttcctgatgataaatgactctttggtacccaccatggttatccctcggtttactggagcgttgtatcccaaaggaaagcagtatccgtatcctaaggcaggtcaaatgaacccaacaataaaattatatgttgtaaacctgtatggaccaactcacactttggagctcatgccacctgacagctttaaatcaagagaatactatatcactatggttaaatgggtaagcaataccaagactgtggtaagatggttaaaccgagctcagaacatctccatcctcacagtctgtgagaccactacaggtgcttgtagtaaaaaatatgagatgacatcagatacgtggctctctcagcagaatgaggagcccgtgttttctagagacggcagcaaattctttatgacagtgcctgttaagcaagggggacgtggagaatttcaccacatagctatgttcctcatccagagtaaaagtgagcaaattaccgtgcggcatctgacatcaggaaactgggaagtgataaagatcttggcatacgatgaaactactcaaaaaatttactttctgagcactgaatcttctcccagaggaaggcagctgtacagtgcttctactgaaggattattgaatcgccaatgcatttcatgtaatttcatgaaagaacaatgtacatattttgatgccagttttagtcccatgaatcaacatttcttattattctgtgaaggtccaagggtcccagtggtcagcctacatagtacggacaacccagcaaaatattttatattggaaagcaattctatgctgaaggaagctatcctgaagaagaagataggaaagccagaaattaaaatccttcatattgacgactatgaacttcctttacagttgtcccttcccaaagattttatggaccgaaaccagtatgctcttctgttaataatggatgaagaaccaggaggccagctggttacagataagttccatattgactgggattccgtactcattgacatggataatgtcattgtagcaagatttgatggcagaggaagtggattccagggtctgaaaattttgcaggagattcatcgaagattaggttcagtagaagtaaaggaccaaataacagctgtgaaatttttgctgaaactgccttacattgactccaaaagattaagcatttttggaaagggttatggtggctatattgcatcaatgatcttaaaatcagatgaaaagctttttaaatgtggatccgtggttgcacctatcacagacttgaaattgtatgcctcagctttctctgaaagataccttgggatgccatctaaggaagaaagcacttaccaggcagccagtgtgctacataatgttcatggcttgaaagaagaaaatatattaataattcatggaactgctgacacaaaagttcatttccaacactcagcagaattaatcaagcacctaataaaagctggagtgaattatactatgcaggtctacccagatgaaggtcataacgtatctgagaagagcaagtatcatctctacagcacaatcctcaaattcttcagtgattgtttgaaggaagaaatatctgtgctaccacaggaaccagaagaagatgaataa
Sequence Length
2391
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
85,480 Da
NCBI Official Full Name
Homo sapiens dipeptidyl-peptidase 10, mRNA
NCBI Official Synonym Full Names
dipeptidyl peptidase like 10
NCBI Official Symbol
DPP10
NCBI Official Synonym Symbols
DPL2; DPPY; DPRP3; DPRP-3
NCBI Protein Information
inactive dipeptidyl peptidase 10
UniProt Protein Name
Inactive dipeptidyl peptidase 10
Protein Family
UniProt Gene Name
DPP10
UniProt Synonym Gene Names
DPRP3; KIAA1492; DPRP-3; DPP X; DPL2
UniProt Entry Name
DPP10_HUMAN
NCBI Description
This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Uniprot Description
DPP10: Has no dipeptidyl aminopeptidase activity. May modulate cell surface expression and activity of the potassium channels KCND1 and KCND2. Genetic variations in DPP10 are associated with susceptibility to asthma (ASTHMA). The most common chronic disease affecting children and young adults. It is a complex genetic disorder with a heterogeneous phenotype, largely attributed to the interactions among many genes and between these genes and the environment. It is characterized by recurrent attacks of paroxysmal dyspnea, with weezing due to spasmodic contraction of the bronchi. Belongs to the peptidase S9B family. DPPIV subfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell surface; Membrane protein, integral
Chromosomal Location of Human Ortholog: 2q14.1
Cellular Component: membrane; plasma membrane
Molecular Function: dipeptidyl-peptidase activity; potassium channel regulator activity
Research Articles on DPP10
Similar Products
Product Notes
The DPP10 dpp10 (Catalog #AAA1274253) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccaaa ctgccagcgt gtcccatcac atcaagtgtc aaccctcaaa aacaatcaag gaactgggaa gtaacagccc tccacagaga aactggaagg gaattgctat tgctctgctg gtgattttag ttgtatgctc actcatcact atgtcagtca tcctcttaac cccagatgaa ctcacaaatt cgtcagaaac cagattgtct ttggaagacc tctttaggaa agactttgtg cttcacgatc cagaggctcg gtggatcaat gatacagatg tggtgtataa aagcgagaat ggacatgtca ttaaactgaa tatagaaaca aatgctacca cattattatt ggaaaacaca acttttgtaa ccttcaaagc atcaagacat tcagtttcac cagatttaaa atatgtcctt ctggcatatg atgtcaaaca gatttttcat tattcatata ctgcttcata tgtgatttac aacatacaca ctagggaagt ttgggagtta aatcctccag aagtagagga ctccgtcttg cagtacgcgg cctggggtgt ccaagggcag cagctgattt atatttttga aaataatatc tactatcaac ctgatataaa gagcagttca ttgcgactga catcttctgg aaaagaagaa ataattttta atgggattgc tgactggtta tatgaagagg aactcctgca ttctcacatc gcccactggt ggtcaccaga tggagaaaga cttgccttcc tgatgataaa tgactctttg gtacccacca tggttatccc tcggtttact ggagcgttgt atcccaaagg aaagcagtat ccgtatccta aggcaggtca aatgaaccca acaataaaat tatatgttgt aaacctgtat ggaccaactc acactttgga gctcatgcca cctgacagct ttaaatcaag agaatactat atcactatgg ttaaatgggt aagcaatacc aagactgtgg taagatggtt aaaccgagct cagaacatct ccatcctcac agtctgtgag accactacag gtgcttgtag taaaaaatat gagatgacat cagatacgtg gctctctcag cagaatgagg agcccgtgtt ttctagagac ggcagcaaat tctttatgac agtgcctgtt aagcaagggg gacgtggaga atttcaccac atagctatgt tcctcatcca gagtaaaagt gagcaaatta ccgtgcggca tctgacatca ggaaactggg aagtgataaa gatcttggca tacgatgaaa ctactcaaaa aatttacttt ctgagcactg aatcttctcc cagaggaagg cagctgtaca gtgcttctac tgaaggatta ttgaatcgcc aatgcatttc atgtaatttc atgaaagaac aatgtacata ttttgatgcc agttttagtc ccatgaatca acatttctta ttattctgtg aaggtccaag ggtcccagtg gtcagcctac atagtacgga caacccagca aaatatttta tattggaaag caattctatg ctgaaggaag ctatcctgaa gaagaagata ggaaagccag aaattaaaat ccttcatatt gacgactatg aacttccttt acagttgtcc cttcccaaag attttatgga ccgaaaccag tatgctcttc tgttaataat ggatgaagaa ccaggaggcc agctggttac agataagttc catattgact gggattccgt actcattgac atggataatg tcattgtagc aagatttgat ggcagaggaa gtggattcca gggtctgaaa attttgcagg agattcatcg aagattaggt tcagtagaag taaaggacca aataacagct gtgaaatttt tgctgaaact gccttacatt gactccaaaa gattaagcat ttttggaaag ggttatggtg gctatattgc atcaatgatc ttaaaatcag atgaaaagct ttttaaatgt ggatccgtgg ttgcacctat cacagacttg aaattgtatg cctcagcttt ctctgaaaga taccttggga tgccatctaa ggaagaaagc acttaccagg cagccagtgt gctacataat gttcatggct tgaaagaaga aaatatatta ataattcatg gaactgctga cacaaaagtt catttccaac actcagcaga attaatcaag cacctaataa aagctggagt gaattatact atgcaggtct acccagatga aggtcataac gtatctgaga agagcaagta tcatctctac agcacaatcc tcaaattctt cagtgattgt ttgaaggaag aaatatctgt gctaccacag gaaccagaag aagatgaata a. It is sometimes possible for the material contained within the vial of "DPP10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
