DNAJB8 cdna clone
DNAJB8 cDNA Clone
Gene Names
DNAJB8; DJ6; CT156
Synonyms
DNAJB8; DNAJB8 cDNA Clone; DNAJB8 cdna clone
Sequence
atggctaactactacgaagtgctgggcgtgcaggccagcgcttccccggaggacatcaagaaagcctaccgcaagctggcccttcgttggcaccccgacaagaaccctgacaataaggaggaggcggagaagaagttcaagctggtgtctgaggcctatgaggttctgtctgactccaagaaacgctccctgtatgaccgtgctggctgtgacagctggcgggctggtggcggggccagcacgccctaccacagccccttcgacaccggctacaccttccgtaaccctgaggacatcttccgggagtttttcggtggcctggaccctttctcctttgagttctgggacagcccattcaatagtgaccgtggtggccggggccatggcctgaggggggccttctcggcaggctttggagaatttccggccttcatggaggccttctcatccttcaacatgctgggctgcagcgggggcagccacaccaccttctcatccacctccttcgggggctccagttctggcagctcggggttcaagtcggtgatgtcgtccaccgagatgatcaatggccacaaggtcaccaccaagcgcatcgtggagaacgggcaggagcgcgtggaggtggaggaagacgggcagctcaagtcggtgactgtgaacggcaaggagcagctcaaatggatggacagcaagtag
Sequence Length
699
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,686 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 8, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member B8
NCBI Official Symbol
DNAJB8
NCBI Official Synonym Symbols
DJ6; CT156
NCBI Protein Information
dnaJ homolog subfamily B member 8
UniProt Protein Name
DnaJ homolog subfamily B member 8
Protein Family
UniProt Gene Name
DNAJB8
UniProt Entry Name
DNJB8_HUMAN
NCBI Description
The protein encoded by this gene belongs to the DNAJ/HSP40 family of proteins that regulate chaperone activity. This family member suppresses aggregation and toxicity of polyglutamine proteins, and the C-terminal tail is essential for this activity. It has been implicated as a cancer-testis antigen and as a cancer stem-like cell antigen involved in renal cell carcinoma. [provided by RefSeq, Jun 2012]
Uniprot Description
DNAJB8: Efficient suppressor of aggregation and toxicity of disease-associated polyglutamine proteins.
Protein type: Chaperone
Chromosomal Location of Human Ortholog: 3q21.3
Cellular Component: cytosol; nucleus
Molecular Function: chaperone binding; unfolded protein binding
Research Articles on DNAJB8
Similar Products
Product Notes
The DNAJB8 dnajb8 (Catalog #AAA1271095) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaact actacgaagt gctgggcgtg caggccagcg cttccccgga ggacatcaag aaagcctacc gcaagctggc ccttcgttgg caccccgaca agaaccctga caataaggag gaggcggaga agaagttcaa gctggtgtct gaggcctatg aggttctgtc tgactccaag aaacgctccc tgtatgaccg tgctggctgt gacagctggc gggctggtgg cggggccagc acgccctacc acagcccctt cgacaccggc tacaccttcc gtaaccctga ggacatcttc cgggagtttt tcggtggcct ggaccctttc tcctttgagt tctgggacag cccattcaat agtgaccgtg gtggccgggg ccatggcctg aggggggcct tctcggcagg ctttggagaa tttccggcct tcatggaggc cttctcatcc ttcaacatgc tgggctgcag cgggggcagc cacaccacct tctcatccac ctccttcggg ggctccagtt ctggcagctc ggggttcaag tcggtgatgt cgtccaccga gatgatcaat ggccacaagg tcaccaccaa gcgcatcgtg gagaacgggc aggagcgcgt ggaggtggag gaagacgggc agctcaagtc ggtgactgtg aacggcaagg agcagctcaa atggatggac agcaagtag. It is sometimes possible for the material contained within the vial of "DNAJB8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
