DMWD cdna clone
DMWD cDNA Clone
Gene Names
DMWD; DMRN9; DMR-N9; gene59; D19S593E
Synonyms
DMWD; DMWD cDNA Clone; DMWD cdna clone
Sequence
atgctcctgcgtgggctcatgaagagctactttgggggcctgctgtgtgtgtgctggagccctgacggccgctacgtggtgacgggtggcgaagatgacctggtcaccgtgtggtccttcaccgagggccgcgtggtggctcgaggccatggccacaagtcctgggtcaacgctgtggcctttgacccctacaccacaagggcagaggaggcggcgacagcagccggtgctgatggggagcggagcggcgaagaggaggaggaggagcccgaggctgcgggcacaggctcggccgggggcgccccgctctctccactgcccaaggctggctccattacttaccgctttggctcggcgggccaggacacgcagttctgcctgtgggacctcactgaagacgtgctctacccgcacccgcccctggcccgcacccgcaccctccctggcacacctggcaccacgccaccggccgccagcagctcgaggggtggcgagcctggcccaggccccctgcctcgctcgctgtcccgctccaacagtctcccgcacccagctggcgggggcaaggcgggcggcccgggtgtggcggcagagcctggcacaccattcagcattggccgcttcgccacgctcacactgcaggagcggcgggaccggggggcagagaaggagcacaagcgctaccacagcctgggcaacatcagccggggtggcagtggcggcagtggcagtggtggggagaagcccagcggccctgttccccgcagccgcctggaccccgccaaggtgctgggcactgcgctgtgcccgcgcatccacgaggtgcccctgctggagccccttgtgtgcaagaagatcgcccaggagcggctcacagtcctcctgttcctggaggactgcatcatcactgcctgccaggagggcctcatctgcacctgggcccggccgggcaaggcgggcatctcctcccaaccaggcaactccccgagtggcacagtggtgtga
Sequence Length
1005
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
70,438 Da
NCBI Official Full Name
Homo sapiens dystrophia myotonica, WD repeat containing, mRNA
NCBI Official Synonym Full Names
dystrophia myotonica, WD repeat containing
NCBI Official Symbol
DMWD
NCBI Official Synonym Symbols
DMRN9; DMR-N9; gene59; D19S593E
NCBI Protein Information
dystrophia myotonica WD repeat-containing protein
UniProt Protein Name
Dystrophia myotonica WD repeat-containing protein
Protein Family
UniProt Gene Name
DMWD
UniProt Synonym Gene Names
DM9
UniProt Entry Name
DMWD_HUMAN
Uniprot Description
DMWD: Could have a regulatory function in meiosis.
Chromosomal Location of Human Ortholog: 19q13.3
Similar Products
Product Notes
The DMWD dmwd (Catalog #AAA1268647) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcctgc gtgggctcat gaagagctac tttgggggcc tgctgtgtgt gtgctggagc cctgacggcc gctacgtggt gacgggtggc gaagatgacc tggtcaccgt gtggtccttc accgagggcc gcgtggtggc tcgaggccat ggccacaagt cctgggtcaa cgctgtggcc tttgacccct acaccacaag ggcagaggag gcggcgacag cagccggtgc tgatggggag cggagcggcg aagaggagga ggaggagccc gaggctgcgg gcacaggctc ggccgggggc gccccgctct ctccactgcc caaggctggc tccattactt accgctttgg ctcggcgggc caggacacgc agttctgcct gtgggacctc actgaagacg tgctctaccc gcacccgccc ctggcccgca cccgcaccct ccctggcaca cctggcacca cgccaccggc cgccagcagc tcgaggggtg gcgagcctgg cccaggcccc ctgcctcgct cgctgtcccg ctccaacagt ctcccgcacc cagctggcgg gggcaaggcg ggcggcccgg gtgtggcggc agagcctggc acaccattca gcattggccg cttcgccacg ctcacactgc aggagcggcg ggaccggggg gcagagaagg agcacaagcg ctaccacagc ctgggcaaca tcagccgggg tggcagtggc ggcagtggca gtggtgggga gaagcccagc ggccctgttc cccgcagccg cctggacccc gccaaggtgc tgggcactgc gctgtgcccg cgcatccacg aggtgcccct gctggagccc cttgtgtgca agaagatcgc ccaggagcgg ctcacagtcc tcctgttcct ggaggactgc atcatcactg cctgccagga gggcctcatc tgcacctggg cccggccggg caaggcgggc atctcctccc aaccaggcaa ctccccgagt ggcacagtgg tgtga. It is sometimes possible for the material contained within the vial of "DMWD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
