DHX35 cdna clone
DHX35 cDNA Clone
Gene Names
DHX35; DDX35; C20orf15; KAIA0875
Synonyms
DHX35; DHX35 cDNA Clone; DHX35 cdna clone
Sequence
atggctgcgcccgtgggaccggtgaagttctggcgacccggtacagaggggccaggtgtaagcatctctgaagagagacaaagtctggctgaaaactctgggacaacggttgtttacaacccttatgctgccctttccatagagcagcagaggcagaagctgccggtattcaagcttaggaatcatattttatacttgatagaaaattatcagacagtggtgattgttggtgaaacaggatgtgggaagagcacacagattcctcagtaccttgcagaagccggctggacagctgaaggaagagtggtaggagtgacccagcctcgaagagtggctgctgttacagttgcagggagagtagctgaagaaaggggtgcagtgctgggccacgaggtgggctactgcatccgctttgatgactgcaccgaccagctggccacgagaattaagtttcttactgatggaatgctggtcagggaaatgatggttgatccgttgttaacaaaatatagtgtcatcatgctggatgaagcccacgagaggaccttgtacactgacattgccattggcttgctaaaaaagattcagaaaaagcgaggggatcttcgattgattgtagcttcagccactctggatgcagacaaattccgggatttctttaatcaaaatgaaaccagtgatccagcaagggatacatgtgtgatccttacagtggaagggagaacatttccggtggatatcttttatctacaaagtcctgttccagattatatcaaatcaactgtcgaaactgtggtgaaaattcaccagacagagggagacggagacgttttagcatttcttactggccaggaagaggtagaaactgttgtgtcgatgctcatcgagcaggctcgagcactagctcgcactgggatgaagagacacctccgagttctccccatgtatgcaggactgccttcctttgagcaaatgaaagtgtttgaaagggtgtcacgcagtgtcagaaaggtgatagtggccaccaatgtggcagaaacctctatcacaatcagcggcattgtgtatgtgatcgactgtggctttgtgaaactccgagcctacaatcccaggacagctattgaatgcttggtggtggtgccagtctcccaggcatcagctaatcagcgagcaggacgtggtggtcgtagtcgctcgggaaaatgttatcgcctttatacagaggaagcctttgacaagttgcctcagtctacggttcctgagatgcagcgtagtaatttggcacctgtcatcctgcagctgaaagcactaggaattgacaatgtcctcaggttccacttcatgtcgccccctccagcacagtcgatggttcaagccttggagttactgtatgctctgggaggtctggacaaagactgtcgcctaactgaaccgcttggcatgagaattgcagagtttcctttgaatcccatgtttgccaaaatgctgcttgaatcaggaaacttcggctgttctcaggaaattctaagcatcgctgccatgatgcagatccagaatatctttgtggtccccccaaaccagaagtctcacgcaattcgagtgcaccgtaaatttgctgtggaggagggcgaccacctcactatgctcaatatatatgaagcatttatcaaacacaataaggactctaaatggtgtcaggaacatttcctgaattacaagggtcttgtcagagctgcgactgtaagagaacaattgaaaaagcttcttgtcaagtttcaagtgcccaggaagtctagtgaaggtgacccggatctggttctgaggtgcattgtctccggcttcttcgccaatgcagcgaggtttcattctactggagcttataggaccatccgtgatgaccatgagctgcacatacaccctgcgtcagtcctctatgcagagaagccgcctcgctgggtcatctataacgaagttatacagacctccaagtactacatgagagatgtgactgccattgaatcggcctggctgttggagctggctccacacttttatcaacaaggaacgcacctgtctctgaaagccaaaagggccaaggtccaggacccgtga
Sequence Length
2112
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
75,440 Da
NCBI Official Full Name
Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 35, mRNA
NCBI Official Synonym Full Names
DEAH-box helicase 35
NCBI Official Symbol
DHX35
NCBI Official Synonym Symbols
DDX35; C20orf15; KAIA0875
NCBI Protein Information
probable ATP-dependent RNA helicase DHX35
UniProt Protein Name
Probable ATP-dependent RNA helicase DHX35
Protein Family
UniProt Gene Name
DHX35
UniProt Synonym Gene Names
C20orf15; DDX35
UniProt Entry Name
DHX35_HUMAN
NCBI Description
DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]
Uniprot Description
DHX35: May be involved in pre-mRNA splicing. Belongs to the DEAD box helicase family. DEAH subfamily.
Protein type: RNA splicing; Helicase; EC 3.6.4.13; Spliceosome
Chromosomal Location of Human Ortholog: 20q11.22-q12
Cellular Component: cytoplasm
Molecular Function: ATP-dependent RNA helicase activity
Biological Process: nuclear mRNA splicing, via spliceosome; RNA processing
Research Articles on DHX35
Similar Products
Product Notes
The DHX35 dhx35 (Catalog #AAA1276316) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcgc ccgtgggacc ggtgaagttc tggcgacccg gtacagaggg gccaggtgta agcatctctg aagagagaca aagtctggct gaaaactctg ggacaacggt tgtttacaac ccttatgctg ccctttccat agagcagcag aggcagaagc tgccggtatt caagcttagg aatcatattt tatacttgat agaaaattat cagacagtgg tgattgttgg tgaaacagga tgtgggaaga gcacacagat tcctcagtac cttgcagaag ccggctggac agctgaagga agagtggtag gagtgaccca gcctcgaaga gtggctgctg ttacagttgc agggagagta gctgaagaaa ggggtgcagt gctgggccac gaggtgggct actgcatccg ctttgatgac tgcaccgacc agctggccac gagaattaag tttcttactg atggaatgct ggtcagggaa atgatggttg atccgttgtt aacaaaatat agtgtcatca tgctggatga agcccacgag aggaccttgt acactgacat tgccattggc ttgctaaaaa agattcagaa aaagcgaggg gatcttcgat tgattgtagc ttcagccact ctggatgcag acaaattccg ggatttcttt aatcaaaatg aaaccagtga tccagcaagg gatacatgtg tgatccttac agtggaaggg agaacatttc cggtggatat cttttatcta caaagtcctg ttccagatta tatcaaatca actgtcgaaa ctgtggtgaa aattcaccag acagagggag acggagacgt tttagcattt cttactggcc aggaagaggt agaaactgtt gtgtcgatgc tcatcgagca ggctcgagca ctagctcgca ctgggatgaa gagacacctc cgagttctcc ccatgtatgc aggactgcct tcctttgagc aaatgaaagt gtttgaaagg gtgtcacgca gtgtcagaaa ggtgatagtg gccaccaatg tggcagaaac ctctatcaca atcagcggca ttgtgtatgt gatcgactgt ggctttgtga aactccgagc ctacaatccc aggacagcta ttgaatgctt ggtggtggtg ccagtctccc aggcatcagc taatcagcga gcaggacgtg gtggtcgtag tcgctcggga aaatgttatc gcctttatac agaggaagcc tttgacaagt tgcctcagtc tacggttcct gagatgcagc gtagtaattt ggcacctgtc atcctgcagc tgaaagcact aggaattgac aatgtcctca ggttccactt catgtcgccc cctccagcac agtcgatggt tcaagccttg gagttactgt atgctctggg aggtctggac aaagactgtc gcctaactga accgcttggc atgagaattg cagagtttcc tttgaatccc atgtttgcca aaatgctgct tgaatcagga aacttcggct gttctcagga aattctaagc atcgctgcca tgatgcagat ccagaatatc tttgtggtcc ccccaaacca gaagtctcac gcaattcgag tgcaccgtaa atttgctgtg gaggagggcg accacctcac tatgctcaat atatatgaag catttatcaa acacaataag gactctaaat ggtgtcagga acatttcctg aattacaagg gtcttgtcag agctgcgact gtaagagaac aattgaaaaa gcttcttgtc aagtttcaag tgcccaggaa gtctagtgaa ggtgacccgg atctggttct gaggtgcatt gtctccggct tcttcgccaa tgcagcgagg tttcattcta ctggagctta taggaccatc cgtgatgacc atgagctgca catacaccct gcgtcagtcc tctatgcaga gaagccgcct cgctgggtca tctataacga agttatacag acctccaagt actacatgag agatgtgact gccattgaat cggcctggct gttggagctg gctccacact tttatcaaca aggaacgcac ctgtctctga aagccaaaag ggccaaggtc caggacccgt ga. It is sometimes possible for the material contained within the vial of "DHX35, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
