Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHRS2 cdna clone

DHRS2 cDNA Clone

Gene Names
DHRS2; HEP27; SDR25C1
Synonyms
DHRS2; DHRS2 cDNA Clone; DHRS2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgtcagcagttgcccggggctaccagggctggtttcatccctgtgctaggctttctgtgaggatgagcagcaccgggatagacaggaagggcgtcctggctaaccgggtagccgtggtcacggggtccaccagtgggatcggctttgccatcgcccgacgtctggcccgggacggggcccacgtggtcatcagcagccggaagcagcagaacgtggaccgggccatggccaagctgcagggggaggggctgagtgtggcgggcattgtgtgccacgtggggaaggctgaggaccgggagcagctggtggccaaggccctggagcactgtgggggcgtcgacttcctggtgtgcagcgcaggggtcaaccctctggtagggagcactctggggaccagtgagcagatctgggacaagatcctaagtgtgaacgtgaagtccccagccctgctgctgagccagttgctgccctacatggagaacaggaggggtgctgtcatcctggtctcttccattgcagcttataatccagtagtggcgctgggtgtctacaatgtcagcaagacagcgctgctgggtctcactagaacactggcattggagctggcccccaaggacatccgggtaaactgcgtggttccaggaattatcaaaactgacttcagcaaagtggtgaggattggtttcatgggaatgagtctctctggaagaacttcaaggaacatcatcagctgcagaggattggggagtcagaggactgtgcaggaatcgtgtccttcctgtgctctccagatgccagctacgtcaacggggagaacattgcggtggcaggctactccactcggctctgagaggagtgggggcggctgcgtagctgtggtcccaggcccaggagcctga
Sequence Length
903
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,496 Da
NCBI Official Full Name
Homo sapiens dehydrogenase/reductase (SDR family) member 2, mRNA
NCBI Official Synonym Full Names
dehydrogenase/reductase 2
NCBI Official Symbol
DHRS2
NCBI Official Synonym Symbols
HEP27; SDR25C1
NCBI Protein Information
dehydrogenase/reductase SDR family member 2, mitochondrial
UniProt Protein Name
Dehydrogenase/reductase SDR family member 2, mitochondrial
UniProt Gene Name
DHRS2
UniProt Synonym Gene Names
SDR25C1
UniProt Entry Name
DHRS2_HUMAN

Uniprot Description

DHRS2: Displays NADPH-dependent dicarbonyl reductase activity in vitro with 3,4-Hexanedione, 2,3-Heptanedione and 1-Phenyl-1,2- propanedione as substrates. No reductase activity is displayed in vitro with steroids, retinoids and sugars as substrates. May inhibit cell replication. Belongs to the short-chain dehydrogenases/reductases (SDR) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 1.1.-.-; Oxidoreductase; EC 1.1.1.-

Chromosomal Location of Human Ortholog: 14q11.2

Cellular Component: cytoplasm; mitochondrion; nuclear envelope; nucleus

Molecular Function: carbonyl reductase (NADPH) activity; protein binding

Biological Process: myeloid dendritic cell differentiation; negative regulation of apoptosis; response to toxin

Research Articles on DHRS2

Similar Products

Product Notes

The DHRS2 dhrs2 (Catalog #AAA1270945) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgtcag cagttgcccg gggctaccag ggctggtttc atccctgtgc taggctttct gtgaggatga gcagcaccgg gatagacagg aagggcgtcc tggctaaccg ggtagccgtg gtcacggggt ccaccagtgg gatcggcttt gccatcgccc gacgtctggc ccgggacggg gcccacgtgg tcatcagcag ccggaagcag cagaacgtgg accgggccat ggccaagctg cagggggagg ggctgagtgt ggcgggcatt gtgtgccacg tggggaaggc tgaggaccgg gagcagctgg tggccaaggc cctggagcac tgtgggggcg tcgacttcct ggtgtgcagc gcaggggtca accctctggt agggagcact ctggggacca gtgagcagat ctgggacaag atcctaagtg tgaacgtgaa gtccccagcc ctgctgctga gccagttgct gccctacatg gagaacagga ggggtgctgt catcctggtc tcttccattg cagcttataa tccagtagtg gcgctgggtg tctacaatgt cagcaagaca gcgctgctgg gtctcactag aacactggca ttggagctgg cccccaagga catccgggta aactgcgtgg ttccaggaat tatcaaaact gacttcagca aagtggtgag gattggtttc atgggaatga gtctctctgg aagaacttca aggaacatca tcagctgcag aggattgggg agtcagagga ctgtgcagga atcgtgtcct tcctgtgctc tccagatgcc agctacgtca acggggagaa cattgcggtg gcaggctact ccactcggct ctgagaggag tgggggcggc tgcgtagctg tggtcccagg cccaggagcc tga. It is sometimes possible for the material contained within the vial of "DHRS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.