Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHDH cdna clone

DHDH cDNA Clone

Gene Names
DHDH; 2DD; HUM2DD
Synonyms
DHDH; DHDH cDNA Clone; DHDH cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctgcgctggggcatcgtgtctgtcggcctcatctccagcgacttcacagccgtgctgcagacgctgcctcgctctgagcaccaggtggtggcggtggcggcccgcgatctgagccgtgcgaaggagtttgcacagaaacacgacatccccaaggcctacggctcctatgaggagctggccaaggacccgagcgtggaggtggcctacattggcacccagcacccccagcacaaggcggcggtgatgctgtgcttggcggcgggcaaggccgttctgtgcgagaagcccacgggcgtgaacgcggcggaagttcgcgagatggtcgcggaggcccgatcccgagccctcttccttatggaggccatctggacccgcttctttcctgcctccgaggctctgaggtctgttttggcccagggaactctaggagacctccgggtggctcgggcagaatttgggaagaatctcatccacgttccccgggccgtagaccgggcccaggctgggggggccctgctggacatcggcatctactgtgtccagttcacctccatggtctttggagggcagaagccagagaagatttctgtcgtgggaaggcgtcatgaaacaggtgtggatgacactgtcacggtgctcctgcagtacccaggggaggtccatggcagcttcacctgcagcatcaccgtgcagctctccaacacggcctccgtgagcggcaccaagggcatggtacagctcctcaacccctgctggtgcccgaccgagctggtggtgaagggggagcataaggagttcccgctgcccccagtcccaaaggactgcaattttgacaacggggcaggcatgagttatgaggccaagcacgtctgggagtgcctacgcaagggtatgaaggaaagtcctgtgattcccctgtcggaaagtgagctcctggctgacatccttgaagaggtgaggaaggccattggagtcaccttcccccaagacaaacgctga
Sequence Length
1005
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,382 Da
NCBI Official Full Name
Homo sapiens dihydrodiol dehydrogenase (dimeric), mRNA
NCBI Official Synonym Full Names
dihydrodiol dehydrogenase
NCBI Official Symbol
DHDH
NCBI Official Synonym Symbols
2DD; HUM2DD
NCBI Protein Information
trans-1,2-dihydrobenzene-1,2-diol dehydrogenase
UniProt Protein Name
Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase
UniProt Gene Name
DHDH
UniProt Synonym Gene Names
2DD
UniProt Entry Name
DHDH_HUMAN

NCBI Description

This gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of transdihydrodiols of aromatic hydrocarbons to corresponding catechols. This enzyme is a dimeric dihydrodiol dehydrogenase, and it differs from monomeric dihydrodiol dehydrogenases in its high substrate specificity for trans-dihydrodiols of aromatic hydrocarbons in the oxidative direction. [provided by RefSeq, Jul 2008]

Uniprot Description

DHDH: an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of transdihydrodiols of aromatic hydrocarbons to corresponding catechols. This enzyme is a dimeric dihydrodiol dehydrogenase, and it differs from monomeric dihydrodiol dehydrogenases in its high substrate specificity for trans-dihydrodiols of aromatic hydrocarbons in the oxidative direction. [provided by RefSeq, Jul 2008]

Protein type: EC 1.3.1.20; Xenobiotic Metabolism - metabolism by cytochrome P450; EC 1.1.1.179; Oxidoreductase

Chromosomal Location of Human Ortholog: 19q13.3

Molecular Function: D-xylose 1-dehydrogenase (NADP+) activity; electron carrier activity; NAD(P) transhydrogenase activity

Biological Process: carbohydrate metabolic process; D-xylose catabolic process

Research Articles on DHDH

Similar Products

Product Notes

The DHDH dhdh (Catalog #AAA1276247) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctgc gctggggcat cgtgtctgtc ggcctcatct ccagcgactt cacagccgtg ctgcagacgc tgcctcgctc tgagcaccag gtggtggcgg tggcggcccg cgatctgagc cgtgcgaagg agtttgcaca gaaacacgac atccccaagg cctacggctc ctatgaggag ctggccaagg acccgagcgt ggaggtggcc tacattggca cccagcaccc ccagcacaag gcggcggtga tgctgtgctt ggcggcgggc aaggccgttc tgtgcgagaa gcccacgggc gtgaacgcgg cggaagttcg cgagatggtc gcggaggccc gatcccgagc cctcttcctt atggaggcca tctggacccg cttctttcct gcctccgagg ctctgaggtc tgttttggcc cagggaactc taggagacct ccgggtggct cgggcagaat ttgggaagaa tctcatccac gttccccggg ccgtagaccg ggcccaggct gggggggccc tgctggacat cggcatctac tgtgtccagt tcacctccat ggtctttgga gggcagaagc cagagaagat ttctgtcgtg ggaaggcgtc atgaaacagg tgtggatgac actgtcacgg tgctcctgca gtacccaggg gaggtccatg gcagcttcac ctgcagcatc accgtgcagc tctccaacac ggcctccgtg agcggcacca agggcatggt acagctcctc aacccctgct ggtgcccgac cgagctggtg gtgaaggggg agcataagga gttcccgctg cccccagtcc caaaggactg caattttgac aacggggcag gcatgagtta tgaggccaag cacgtctggg agtgcctacg caagggtatg aaggaaagtc ctgtgattcc cctgtcggaa agtgagctcc tggctgacat ccttgaagag gtgaggaagg ccattggagt caccttcccc caagacaaac gctga. It is sometimes possible for the material contained within the vial of "DHDH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.