Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DENR cdna clone

DENR cDNA Clone

Gene Names
DENR; DRP; DRP1; SMAP-3
Synonyms
DENR; DENR cDNA Clone; DENR cdna clone
Ordering
For Research Use Only!
Sequence
atggctgctgacatttctgaatccagcggggctgactgcaaaggagacccaaggaacagtgccaagttagatgccgattacccacttcgagtcctttattgtggagtctgttcattaccaacagagtactgtgaatatatgcctgatgttgctaaatgtagacaatggttagagaagaattttccaaatgaatttgcaaaacttactgtagaaaattcacccaaacaagaagctggaattagtgagggtcaaggaacagcaggggaagaagaggagaagaaaaaacagaagagaggtggaaggggtcaaataaaacaaaaaaagaagaccgtaccacaaaaggttactatagccaaaattcccagagcaaagaagaaatatgtgacaagagtatgtggccttgcaacttttgaaattgatcttaaagaagcacaaagattttttgctcaaaaattctcctgtggtgcctcagtaacaggggaggatgaaattatcattcagggagattttacagatgacataattgatgtcattcaggaaaaatggccagaggtagatgatgacagcatcgaagatcttggagaagtaaagaagtga
Sequence Length
597
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,092 Da
NCBI Official Full Name
Homo sapiens density-regulated protein, mRNA
NCBI Official Synonym Full Names
density regulated re-initiation and release factor
NCBI Official Symbol
DENR
NCBI Official Synonym Symbols
DRP; DRP1; SMAP-3
NCBI Protein Information
density-regulated protein
UniProt Protein Name
Density-regulated protein
Protein Family
UniProt Gene Name
DENR
UniProt Synonym Gene Names
DRP1; DRP; SMAP-3
UniProt Entry Name
DENR_HUMAN

NCBI Description

This gene encodes a protein whose expression was found to increase in cultured cells at high density but not during growth arrest. This gene was also shown to have increased expression in cells overexpressing HER-2/neu proto-oncogene. The protein contains an SUI1 domain. In budding yeast, SUI1 is a translation initiation factor that along with eIF-2 and the initiator tRNA-Met, directs the ribosome to the proper translation start site. Proteins similar to SUI have been found in mammals, insects, and plants. [provided by RefSeq, Jul 2008]

Uniprot Description

DENR: May be involved in the translation of target mRNAs by scanning and recognition of the initiation codon. Plays a role in the modulation of the translational profile of a subset of cancer- related mRNAs when recruited to the translational initiation complex by the oncogene MCTS1. Belongs to the DENR family.

Protein type: Translation; RNA-binding

Chromosomal Location of Human Ortholog: 12q24.31

Molecular Function: protein binding

Biological Process: formation of translation preinitiation complex; ribosome disassembly

Research Articles on DENR

Similar Products

Product Notes

The DENR denr (Catalog #AAA1268125) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgctg acatttctga atccagcggg gctgactgca aaggagaccc aaggaacagt gccaagttag atgccgatta cccacttcga gtcctttatt gtggagtctg ttcattacca acagagtact gtgaatatat gcctgatgtt gctaaatgta gacaatggtt agagaagaat tttccaaatg aatttgcaaa acttactgta gaaaattcac ccaaacaaga agctggaatt agtgagggtc aaggaacagc aggggaagaa gaggagaaga aaaaacagaa gagaggtgga aggggtcaaa taaaacaaaa aaagaagacc gtaccacaaa aggttactat agccaaaatt cccagagcaa agaagaaata tgtgacaaga gtatgtggcc ttgcaacttt tgaaattgat cttaaagaag cacaaagatt ttttgctcaa aaattctcct gtggtgcctc agtaacaggg gaggatgaaa ttatcattca gggagatttt acagatgaca taattgatgt cattcaggaa aaatggccag aggtagatga tgacagcatc gaagatcttg gagaagtaaa gaagtga. It is sometimes possible for the material contained within the vial of "DENR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.