Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DEFA3 cdna clone

DEFA3 cDNA Clone

Gene Names
DEFA3; HP3; DEF3; HNP3; HP-3; HNP-3
Synonyms
DEFA3; DEFA3 cDNA Clone; DEFA3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggaccctcgccatccttgctgccattctcctggtggccctgcaggcccaggctgagccactccaggcaagagctgatgaggttgctgcagccccggagcagattgcagcggacatcccagaagtggttgtttcccttgcatgggacgaaagcttggctccaaagcatccaggctcaaggaaaaacatggactgctattgcagaataccagcgtgcattgcaggagaacgtcgctatggaacctgcatctaccagggaagactctgggcattctgctgctga
Sequence Length
285
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,245 Da
NCBI Official Full Name
Homo sapiens defensin, alpha 3, neutrophil-specific, mRNA
NCBI Official Synonym Full Names
defensin alpha 3
NCBI Official Symbol
DEFA3
NCBI Official Synonym Symbols
HP3; DEF3; HNP3; HP-3; HNP-3
NCBI Protein Information
neutrophil defensin 3
UniProt Protein Name
Neutrophil defensin 3
Protein Family
UniProt Gene Name
DEFA3
UniProt Synonym Gene Names
DEF3; HP-3; HP3; HP-2; HP2
UniProt Entry Name
DEF3_HUMAN

NCBI Description

Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 3, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 1 by only one amino acid. This gene and the gene encoding defensin, alpha 1 are both subject to copy number variation. [provided by RefSeq, Oct 2014]

Uniprot Description

defensin, alpha 3: Defensin 2 and defensin 3 have antibiotic, fungicide and antiviral activities. Has antimicrobial activity against Gram- negative and Gram-positive bacteria. Defensins are thought to kill microbes by permeabilizing their plasma membrane. Belongs to the alpha-defensin family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 8p23.1

Cellular Component: extracellular region; extracellular space; Golgi lumen

Biological Process: antibacterial humoral response; defense response to Gram-positive bacterium; estrogen receptor signaling pathway; innate immune response; innate immune response in mucosa

Research Articles on DEFA3

Similar Products

Product Notes

The DEFA3 defa3 (Catalog #AAA1277832) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggaccc tcgccatcct tgctgccatt ctcctggtgg ccctgcaggc ccaggctgag ccactccagg caagagctga tgaggttgct gcagccccgg agcagattgc agcggacatc ccagaagtgg ttgtttccct tgcatgggac gaaagcttgg ctccaaagca tccaggctca aggaaaaaca tggactgcta ttgcagaata ccagcgtgca ttgcaggaga acgtcgctat ggaacctgca tctaccaggg aagactctgg gcattctgct gctga. It is sometimes possible for the material contained within the vial of "DEFA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.