Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX42 cdna clone

DDX42 cDNA Clone

Gene Names
DDX42; RHELP; RNAHP; SF3B8; DDX42P; SF3b125
Synonyms
DDX42; DDX42 cDNA Clone; DDX42 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgaagtggaggatcaggcagctagagacatgaagaggcttgaagaaaaggacaaggaaagaaaaaacgtaaagggtattcgagatgacattgaagaggaagatgaccaagaagcttattttcgatacatggcagaaaacccaactgctggtgtggttcaggaggaagaggaagacaatctagaatatgatagtgacggaaatccaattgcacctaccaaaaaaatcattgatcctcttccccccattgatcattcagagattgactatccaccatttgaaaaaaacttttacaatgagcatgaagagataaccaacctcactccacagcagttaatagatctccggcataagctcaatcttcgggtctctggtgctgcacctcctagaccaggaagtagctttgctcattttgggtttgacgaacaacttatgcaccagattcggaaatctgaatacacacagcccactccaatacagtgccagggtgtgcctgtggcattaagtggtagagacatgattggtattgccaaaacaggtagtgggaaaactgcagccttcatttggcccatgttgattcatataatggaccagaaggagttggaaccaggtgatggaccaattgcagtgattgtgtgtcctaccagggagctttgccagcagatccatgcagaatgtaagcggtttggaaaagcatataatcttcgatcagtggccgtatatggaggagggagtatgtgggagcaggccaaggcccttcaggagggggcagagattgttgtgtgtaccccaggtcgactgatagatcatgtgaaaaagaaagctaccaatcttcaaagagtctcttaccttgtgtttgatgaagcagatcgaatgtttgacatgggatttgagtaccaagttcgatccatagcaagtcatgttcgtcctgacaggcagactctcttatttagtgcaacttttcggaagaagattgaaaagttggccagagacatcctgatcgaccctattcgagtggtgcagggagatattggagaggcaaatgaagatgtgacacagattgtggagattctccattctggacctagtaaatggaactggcttacccggcgtctggtagaatttacctcttcagggagtgtcctcctctttgttactaaaaaagccaatgctgaagagctagcgaataaccttaaacaggagggtcataatcttgggctgctccatggggatatggatcagagtgagagaaacaaggtcatttcagactttaagaaaaaggacatcccagtcctggtggccacagatgttgcagcccgtggtctggacattccttcaattaagactgtcattaactatgatgtggcacgagacattgatacccacacgcataggattggccgcacaggaagagcgggtgagaaaggtgtggcctataccctactcactcccaaggacagcaattttgctggtgacctggtccggaacttggaaggagccaatcaacacgtttctaaggaactcctagatctggcaatgcagaatgcctggtttcggaaatctcgattcaaaggagggaaaggaaaaaagctgaacattggtggaggaggcctaggctacagggagcggcctggcctgggctctgagaacatggatcgaggaaataacaatgtaatgagcaattatgaggcctacaagccttccacaggagctatgggagatcgactaacggcaatgaaagcagctttccagtcacagtacaagagtcactttgttgcagccagtttaagtaatcagaaggctggaagttctgctgctggggcaagtgggtggactagtgcagggagcttgaattctgttccaactaactcagcacaacagggccataacagtcctgacagccccgtcaccagtgccgccaagggcatcccaggctttggcaatactggcaacatcagtggtgcccctgtgacctacccgtctgccggagcccaaggagtcaacaacacagcttcagggaataacagccgagaagggactgggggcagcaacgggaaaagagagagatatactgagaaccggggcagcagccgtcacagtcacggagagactggcaatcggcatagcgatagtccacgtcacggagatggtggtcgccatggagatggataccgccatccagaaagcagcagccgtcatactgatggccatcggcacggggagaacagacatggaggaagcgcaggccggcatggggagaaccggggtgcaaatgatggtcggaatggggaaagcaggaaagaagcttttaatcgtgagagcaagatggagcccaagatggaacccaaagtggacagcagcaagatggacaaggtggacagcaagacagataagacagctgacggctttgctgtcccagagccgcctaaacgcaagaaaagtcgatgggacagttag
Sequence Length
2460
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,068 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 42, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 42
NCBI Official Symbol
DDX42
NCBI Official Synonym Symbols
RHELP; RNAHP; SF3B8; DDX42P; SF3b125
NCBI Protein Information
ATP-dependent RNA helicase DDX42
UniProt Protein Name
ATP-dependent RNA helicase DDX42
UniProt Gene Name
DDX42
UniProt Synonym Gene Names
RHELP; RNAHP; SF3b125
UniProt Entry Name
DDX42_HUMAN

NCBI Description

This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX42: ATP-dependent RNA helicase. Binds to partially double- stranded RNAs (dsRNAs) in order to unwind RNA secondary structures. Unwinding is promoted in the presence of single-strand binding proteins. Mediates also RNA duplex formation thereby displacing the single-strand RNA binding protein. ATP and ADP modulate its activity: ATP binding and hydrolysis by DDX42 triggers RNA strand separation, whereas the ADP-bound form of the protein triggers annealing of complementary RNA strands. Involved in the survival of cells by interacting with TP53BP2 and thereby counteracting the apoptosis-stimulating activity of TP53BP2. Relocalizes TP53BP2 to the cytoplasm. Belongs to the DEAD box helicase family. DDX42 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Helicase; EC 3.6.4.13

Chromosomal Location of Human Ortholog: 17q23.3

Cellular Component: cytoplasm; membrane; nucleoplasm; nucleus

Molecular Function: ATP-dependent RNA helicase activity; protein binding

Biological Process: protein localization; RNA secondary structure unwinding

Research Articles on DDX42

Similar Products

Product Notes

The DDX42 ddx42 (Catalog #AAA1269079) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgaag tggaggatca ggcagctaga gacatgaaga ggcttgaaga aaaggacaag gaaagaaaaa acgtaaaggg tattcgagat gacattgaag aggaagatga ccaagaagct tattttcgat acatggcaga aaacccaact gctggtgtgg ttcaggagga agaggaagac aatctagaat atgatagtga cggaaatcca attgcaccta ccaaaaaaat cattgatcct cttcccccca ttgatcattc agagattgac tatccaccat ttgaaaaaaa cttttacaat gagcatgaag agataaccaa cctcactcca cagcagttaa tagatctccg gcataagctc aatcttcggg tctctggtgc tgcacctcct agaccaggaa gtagctttgc tcattttggg tttgacgaac aacttatgca ccagattcgg aaatctgaat acacacagcc cactccaata cagtgccagg gtgtgcctgt ggcattaagt ggtagagaca tgattggtat tgccaaaaca ggtagtggga aaactgcagc cttcatttgg cccatgttga ttcatataat ggaccagaag gagttggaac caggtgatgg accaattgca gtgattgtgt gtcctaccag ggagctttgc cagcagatcc atgcagaatg taagcggttt ggaaaagcat ataatcttcg atcagtggcc gtatatggag gagggagtat gtgggagcag gccaaggccc ttcaggaggg ggcagagatt gttgtgtgta ccccaggtcg actgatagat catgtgaaaa agaaagctac caatcttcaa agagtctctt accttgtgtt tgatgaagca gatcgaatgt ttgacatggg atttgagtac caagttcgat ccatagcaag tcatgttcgt cctgacaggc agactctctt atttagtgca acttttcgga agaagattga aaagttggcc agagacatcc tgatcgaccc tattcgagtg gtgcagggag atattggaga ggcaaatgaa gatgtgacac agattgtgga gattctccat tctggaccta gtaaatggaa ctggcttacc cggcgtctgg tagaatttac ctcttcaggg agtgtcctcc tctttgttac taaaaaagcc aatgctgaag agctagcgaa taaccttaaa caggagggtc ataatcttgg gctgctccat ggggatatgg atcagagtga gagaaacaag gtcatttcag actttaagaa aaaggacatc ccagtcctgg tggccacaga tgttgcagcc cgtggtctgg acattccttc aattaagact gtcattaact atgatgtggc acgagacatt gatacccaca cgcataggat tggccgcaca ggaagagcgg gtgagaaagg tgtggcctat accctactca ctcccaagga cagcaatttt gctggtgacc tggtccggaa cttggaagga gccaatcaac acgtttctaa ggaactccta gatctggcaa tgcagaatgc ctggtttcgg aaatctcgat tcaaaggagg gaaaggaaaa aagctgaaca ttggtggagg aggcctaggc tacagggagc ggcctggcct gggctctgag aacatggatc gaggaaataa caatgtaatg agcaattatg aggcctacaa gccttccaca ggagctatgg gagatcgact aacggcaatg aaagcagctt tccagtcaca gtacaagagt cactttgttg cagccagttt aagtaatcag aaggctggaa gttctgctgc tggggcaagt gggtggacta gtgcagggag cttgaattct gttccaacta actcagcaca acagggccat aacagtcctg acagccccgt caccagtgcc gccaagggca tcccaggctt tggcaatact ggcaacatca gtggtgcccc tgtgacctac ccgtctgccg gagcccaagg agtcaacaac acagcttcag ggaataacag ccgagaaggg actgggggca gcaacgggaa aagagagaga tatactgaga accggggcag cagccgtcac agtcacggag agactggcaa tcggcatagc gatagtccac gtcacggaga tggtggtcgc catggagatg gataccgcca tccagaaagc agcagccgtc atactgatgg ccatcggcac ggggagaaca gacatggagg aagcgcaggc cggcatgggg agaaccgggg tgcaaatgat ggtcggaatg gggaaagcag gaaagaagct tttaatcgtg agagcaagat ggagcccaag atggaaccca aagtggacag cagcaagatg gacaaggtgg acagcaagac agataagaca gctgacggct ttgctgtccc agagccgcct aaacgcaaga aaagtcgatg ggacagttag. It is sometimes possible for the material contained within the vial of "DDX42, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.