Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DCP2 cdna clone

DCP2 cDNA Clone

Gene Names
DCP2; NUDT20
Synonyms
DCP2; DCP2 cDNA Clone; DCP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggagaccaaacgggtggagattcccggcagcgtcctggacgatctctgcagccgatttattttgcatattcccagcgaggaaagagacaatgcaatccgagtgtgttttcagattgaacttgcccattggttttacttggatttctacatgcagaacacaccaggattacctcagtgtgggataagagactttgctaaagctgtcttcagtcattgtccgtttttgctgcctcaaggtgaagatgtggaaaaagttttggatgaatggaaggaatataaaatgggagtaccaacatatggtgcaattattcttgatgagacacttgaaaatgtactactagttcaggggtacctagcaaaatcaggctggggatttccaaaaggaaaagtaaataaagaagaagctcctcatgattgtgctgctagagaggtctttgaagaaactggttttgatatcaaagactatatttgtaaggatgattacattgaacttcgaatcaatgaccagcttgctcgtttgtacatcattccaggaattccaaaagacacaaaatttaacccaaaaactagaagagaaattcggaacattgagtggttctctattgagaaattgccttgtcatagaaatgatatgacccccaaatccaaacttggtttggcacctaacaaattttttatggccattccctttatcagaccattaagggactggctttctcgaagatttggcgattcctcagacagtgacaatggattttcctcaactggtagcacgccggctaaacccactgtggaaaaattgagtcgaaccaaattccgccacagtcagcagttatttcctgacggttctcctggtgaccagtgggtaaagcacaggcaaccactgcagcaaaagccatataataatcattctgaaatgtctgaccttttaaaaggaaagaagtgtgaaaagaaacttcatccacggaaacttcaggataattttgaaacagatgctgtatatgacttgcctagctccagtgaagaccagttgctagaacatgctgagggacagcccgtggcatgtaatggacattgcaagttccccttttcatccagagcctttttgagtttcaagtttgaccataatgctataatgaaaatcttggacctttga
Sequence Length
1158
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,443 Da
NCBI Official Full Name
Homo sapiens DCP2 decapping enzyme homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
decapping mRNA 2
NCBI Official Symbol
DCP2
NCBI Official Synonym Symbols
NUDT20
NCBI Protein Information
m7GpppN-mRNA hydrolase
UniProt Protein Name
m7GpppN-mRNA hydrolase
Protein Family
UniProt Gene Name
DCP2
UniProt Synonym Gene Names
NUDT20; Nudix motif 20; hDpc
UniProt Entry Name
DCP2_HUMAN

NCBI Description

The protein encoded by this gene is a key component of an mRNA-decapping complex required for degradation of mRNAs, both in normal mRNA turnover, and in nonsense-mediated mRNA decay (NMD). It removes the 7-methyl guanine cap structure from mRNA, prior to its degradation from the 5' end. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]

Uniprot Description

DCP2: Necessary for the degradation of mRNAs, both in normal mRNA turnover and in nonsense-mediated mRNA decay. Plays a role in replication-dependent histone mRNA degradation. Removes the 7- methyl guanine cap structure from mRNA molecules, yielding a 5'- phosphorylated mRNA fragment and 7m-GDP. Has higher activity towards mRNAs that lack a poly(A) tail. Has no activity towards a cap structure lacking a RNA moiety. Belongs to the Nudix hydrolase family. DCP2 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.1.62; Hydrolase; RNA processing

Chromosomal Location of Human Ortholog: 5q22.2

Cellular Component: cell junction; cytosol; intracellular membrane-bound organelle; nucleoplasm

Molecular Function: exoribonuclease activity, producing 5'-phosphomonoesters; m7G(5')pppN diphosphatase activity; protein binding

Biological Process: deadenylation-dependent decapping; mRNA catabolic process; mRNA catabolic process, nonsense-mediated decay; regulation of mRNA stability

Research Articles on DCP2

Similar Products

Product Notes

The DCP2 dcp2 (Catalog #AAA1271940) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacca aacgggtgga gattcccggc agcgtcctgg acgatctctg cagccgattt attttgcata ttcccagcga ggaaagagac aatgcaatcc gagtgtgttt tcagattgaa cttgcccatt ggttttactt ggatttctac atgcagaaca caccaggatt acctcagtgt gggataagag actttgctaa agctgtcttc agtcattgtc cgtttttgct gcctcaaggt gaagatgtgg aaaaagtttt ggatgaatgg aaggaatata aaatgggagt accaacatat ggtgcaatta ttcttgatga gacacttgaa aatgtactac tagttcaggg gtacctagca aaatcaggct ggggatttcc aaaaggaaaa gtaaataaag aagaagctcc tcatgattgt gctgctagag aggtctttga agaaactggt tttgatatca aagactatat ttgtaaggat gattacattg aacttcgaat caatgaccag cttgctcgtt tgtacatcat tccaggaatt ccaaaagaca caaaatttaa cccaaaaact agaagagaaa ttcggaacat tgagtggttc tctattgaga aattgccttg tcatagaaat gatatgaccc ccaaatccaa acttggtttg gcacctaaca aattttttat ggccattccc tttatcagac cattaaggga ctggctttct cgaagatttg gcgattcctc agacagtgac aatggatttt cctcaactgg tagcacgccg gctaaaccca ctgtggaaaa attgagtcga accaaattcc gccacagtca gcagttattt cctgacggtt ctcctggtga ccagtgggta aagcacaggc aaccactgca gcaaaagcca tataataatc attctgaaat gtctgacctt ttaaaaggaa agaagtgtga aaagaaactt catccacgga aacttcagga taattttgaa acagatgctg tatatgactt gcctagctcc agtgaagacc agttgctaga acatgctgag ggacagcccg tggcatgtaa tggacattgc aagttcccct tttcatccag agcctttttg agtttcaagt ttgaccataa tgctataatg aaaatcttgg acctttga. It is sometimes possible for the material contained within the vial of "DCP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.