Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DAOA cdna clone

DAOA cDNA Clone

Gene Names
DAOA; LG72; SG72
Synonyms
DAOA; DAOA cDNA Clone; DAOA cdna clone
Ordering
For Research Use Only!
Sequence
ATGCTGGAAAAGCTGATGGGTGCTGATTCTCTCCAGCTTTTCAGATCCAGATATACATTGGGTAAAATCTACTTCATAGGTTTTCAAAGGAGCATTCTTCTGAGCAAATCTGAAAACTCTCTAAACTCTATTGCAAAGGAGACAGAAGAAGGAAGAGAGACGGTAACAAGGAAAGAAGGATGGAAGAGAAGGCATGAGGACGGCTATTTGGAAATGGCACAGAGGCATTTACAGAGATCATTATGTCCTTGGGTCTCTTACCTTCCTCAGCCCTATGCAGAGCTTGAAGAAGTAAGCAGCCATGTTGGAAAAGTCTTCATGGCAAGAAACTATGAGTTCCTTGCCTATGAGGCCTCTAAGGACCGCAGGCAGCCTCTAGAACGAATGTGGACCTGCAACTACAACCAGCAAAAAGACCAGTCATGCAACCACAAGGAAATAACTTCTACCAAAGCTGAATGA
Sequence Length
462
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,719 Da
NCBI Official Full Name
Homo sapiens D-amino acid oxidase activator, mRNA
NCBI Official Synonym Full Names
D-amino acid oxidase activator
NCBI Official Symbol
DAOA
NCBI Official Synonym Symbols
LG72; SG72
NCBI Protein Information
D-amino acid oxidase activator
UniProt Protein Name
D-amino acid oxidase activator
UniProt Gene Name
DAOA
UniProt Synonym Gene Names
G72
UniProt Entry Name
DAOA_HUMAN

NCBI Description

This gene encodes a protein that may function as an activator of D-amino acid oxidase, which degrades the gliotransmitter D-serine, a potent activator of N-methyl-D-aspartate (NMDA) type glutamate receptors. Studies also suggest that one encoded isoform may play a role in mitochondrial function and dendritic arborization. Polymorphisms in this gene have been implicated in susceptibility to schizophrenia and bipolar affective disorder. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Mar 2011]

Uniprot Description

DAOA: Seems to activate D-amino acid oxidase. 4 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 13q33.2|13q34

Cellular Component: Golgi apparatus; mitochondrion; perinuclear region of cytoplasm

Molecular Function: enzyme activator activity; enzyme binding

Biological Process: positive regulation of catalytic activity

Disease: Schizophrenia

Research Articles on DAOA

Similar Products

Product Notes

The DAOA daoa (Catalog #AAA1277502) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCTGGAAA AGCTGATGGG TGCTGATTCT CTCCAGCTTT TCAGATCCAG ATATACATTG GGTAAAATCT ACTTCATAGG TTTTCAAAGG AGCATTCTTC TGAGCAAATC TGAAAACTCT CTAAACTCTA TTGCAAAGGA GACAGAAGAA GGAAGAGAGA CGGTAACAAG GAAAGAAGGA TGGAAGAGAA GGCATGAGGA CGGCTATTTG GAAATGGCAC AGAGGCATTT ACAGAGATCA TTATGTCCTT GGGTCTCTTA CCTTCCTCAG CCCTATGCAG AGCTTGAAGA AGTAAGCAGC CATGTTGGAA AAGTCTTCAT GGCAAGAAAC TATGAGTTCC TTGCCTATGA GGCCTCTAAG GACCGCAGGC AGCCTCTAGA ACGAATGTGG ACCTGCAACT ACAACCAGCA AAAAGACCAG TCATGCAACC ACAAGGAAAT AACTTCTACC AAAGCTGAAT GA. It is sometimes possible for the material contained within the vial of "DAOA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.