Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DAB1 cdna clone

DAB1 cDNA Clone

Synonyms
DAB1; DAB1 cDNA Clone; DAB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaactgagacagaacttcaagtagctgtgaaaaccagcgccaagaaagactccagaaagaaaggtcaggatcgcagtgaagccactttgataaagaggtttaaaggtgaaggggtccggtacaaagccaaattgatcgggattgatgaagtttccgcagctcggggagacatgttatgtcaagattccatgatgaaactcaagggcgttgttgctggcgctcgttccaaaggagaacacaaacagaaaatctttttaaccatctcctttggaggaatcaaaatctttgatgagaagacaggggttcccaccagccaaaagaaggaaggtgtttatgatgtgccaaaaagtcaacctgtaagtaatggctattcgtttgaggattttgaagaacggtttgctgcagccaccccgaacagaaacctgcccacagactttgatgagatttttgaggcaacgaaggctgtgacccaattagaactttttggggacatgtccacaccccctgatataacctctccttccactcctgcaactccaggtgatgcctttatcccatcttcatctcagacccttccagcgagtgcagatgtgtttagttctgtacctttcggcactgctgctgtaccctcaggttacgttgcaatgggcgctgtcctcccgtccttctggggtcagcagcccctcgtccaacagcagatggtcatgggtgcccagccaccagtcgctcaggtgatgccgggggctcagcccatcgcatggggccagccgggtctctttcctgccactcagcagccctggccaactgtggccgggcagtttccgccagccgccttcatgcccacacaaactgttatgcctttgccagctgccatgttccaaggtcccctcaccccccttgccaccgtcccaggcacgagtgactccaccaggtcaagtccacagaccgacaagcccaggcagaaaatgggcaaagaaacgtttaaggatttccagatggcccagcctccgcccgtgccctcccgcaaacccgaccagccctccctcacctgtacctcagaggccttctccagttacttcaacaaagtcggggtggcacaggatacagacgactgtgatgactttgacatctcccagttgaatttgacccctgtgacttctaccacaccatcgaccaactcacctccaaccccagcccctagacagagctctccatccaaatcatctgcatcccatgccagtgatcctaccacagatgacatctttgaagagggctttgaaagtcccagcaaaagcgaagagcaagaagctcctgatggatcacaggcctcatccaacagtgatccatttggtgagcccagtggggagcccagtggtgataatataagtccacaggccggtagctag
Sequence Length
1410
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,950 Da
NCBI Official Full Name
Homo sapiens disabled homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
DAB1, reelin adaptor protein
NCBI Official Symbol
DAB1
NCBI Protein Information
disabled homolog 1
UniProt Protein Name
Disabled homolog 1
Protein Family
UniProt Gene Name
DAB1
UniProt Entry Name
DAB1_HUMAN

NCBI Description

The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

DAB1: an adaptor molecule functioning in neural development. The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. Thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. Associates with the SH2 domains of Src, Fyn and Abl. Phosphorylated in response to reelin induction in embryonic neurons

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 1p32-p31

Cellular Component: intracellular membrane-bound organelle; microtubule organizing center; nucleolus

Molecular Function: protein binding

Research Articles on DAB1

Similar Products

Product Notes

The DAB1 dab1 (Catalog #AAA1276261) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaactg agacagaact tcaagtagct gtgaaaacca gcgccaagaa agactccaga aagaaaggtc aggatcgcag tgaagccact ttgataaaga ggtttaaagg tgaaggggtc cggtacaaag ccaaattgat cgggattgat gaagtttccg cagctcgggg agacatgtta tgtcaagatt ccatgatgaa actcaagggc gttgttgctg gcgctcgttc caaaggagaa cacaaacaga aaatcttttt aaccatctcc tttggaggaa tcaaaatctt tgatgagaag acaggggttc ccaccagcca aaagaaggaa ggtgtttatg atgtgccaaa aagtcaacct gtaagtaatg gctattcgtt tgaggatttt gaagaacggt ttgctgcagc caccccgaac agaaacctgc ccacagactt tgatgagatt tttgaggcaa cgaaggctgt gacccaatta gaactttttg gggacatgtc cacaccccct gatataacct ctccttccac tcctgcaact ccaggtgatg cctttatccc atcttcatct cagacccttc cagcgagtgc agatgtgttt agttctgtac ctttcggcac tgctgctgta ccctcaggtt acgttgcaat gggcgctgtc ctcccgtcct tctggggtca gcagcccctc gtccaacagc agatggtcat gggtgcccag ccaccagtcg ctcaggtgat gccgggggct cagcccatcg catggggcca gccgggtctc tttcctgcca ctcagcagcc ctggccaact gtggccgggc agtttccgcc agccgccttc atgcccacac aaactgttat gcctttgcca gctgccatgt tccaaggtcc cctcaccccc cttgccaccg tcccaggcac gagtgactcc accaggtcaa gtccacagac cgacaagccc aggcagaaaa tgggcaaaga aacgtttaag gatttccaga tggcccagcc tccgcccgtg ccctcccgca aacccgacca gccctccctc acctgtacct cagaggcctt ctccagttac ttcaacaaag tcggggtggc acaggataca gacgactgtg atgactttga catctcccag ttgaatttga cccctgtgac ttctaccaca ccatcgacca actcacctcc aaccccagcc cctagacaga gctctccatc caaatcatct gcatcccatg ccagtgatcc taccacagat gacatctttg aagagggctt tgaaagtccc agcaaaagcg aagagcaaga agctcctgat ggatcacagg cctcatccaa cagtgatcca tttggtgagc ccagtgggga gcccagtggt gataatataa gtccacaggc cggtagctag. It is sometimes possible for the material contained within the vial of "DAB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.