Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CWF19L1 cdna clone

CWF19L1 cDNA Clone

Gene Names
CWF19L1; C19L1; hDrn1; SCAR17
Synonyms
CWF19L1; CWF19L1 cDNA Clone; CWF19L1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcacagaaaccgctgcgcctcttggcttgtggagatgttgaaggaaagtttgatattttattcaatagagttcaagcaattcagaagaaaagtggaaactttgatctgctgttgtgtgtaggaaatttctttggctccacccaagatgctgaatgggaggagtataagactggcatcaagaaagttcctattcagacatatgtgcttggtgctaataaccaggaaacagtaaaatatttccaggatgctgatggatgtgaattagctgaaaacattacttatctgggtcgtaaaggtatcttcactggaagctcggggctgcagattgtgtacctcagtgggacagaatccttaaatgagccagtaccaggttatagttttagtcccaaggatgtgtcttctctgagaatgatgctgtgtacaacctcccagtttaagggtgttgatatcttgctcacatccccatggcccaagtgtgtggggaactttgggaattcttctggagaagtggataccaaaaaatgtggttctgctttggtttccagtcttgccacgggcttgaaaccaagataccattttgctgctttggaaaagacctattatgagaggcttccatatcgaaaccatatcattctacaggaaaatgcacagcatgccacccggtttatagctctggcaaatgttggaaatccagaaaagaaaaagtatctttacgcgttcagtattgttcccatgaagctaatggatgcagcagaactggtaaaacagcctccggatgtcactgaaaacccttacagaaaatctgggcaggaagcatccataggaaagcaaattcttgcccctgtggaagaatcagcctgtcagtttttctttgatttaaatgaaaagcagggaaggaagcgttcatccacaggtagagatagcaaatcttctcctcatccaaagcagcctcgcaaacctcctcagcctccaggaccctgctggttttgccttgctagccctgaagtggaaaaacatttggtggtcaacatcggcacacattgctaccttgccctggccaaaggaggcttatctgatgaccatgtcctcatcctgcctattggacactaccagtcagtggtggagctttcagcagaggtggtagaagaggtggagaagtataaggccactctgagacggttctttaagagtcgagggaaatggtgtgttgtatttgagagaaattataagagccatcacctccagctacaggtcattcctgtcccaatcagctgctctactactgatgacattaaagatgccttcattacccaggcacaggagcagcagatagagctgttggaaatcccagagcactctgacatcaagcagattgcacagccaggagcagcatatttttatgttgaacttgacacaggagaaaagcttttccacagaattaaaaagaattttcctttgcagtttggaagggaggtcctggccagtgaagccatccttaatgttcctgataagtctgactggaggcagtgtcagatcagcaaggaagacgaggagaccctggctcgccgcttccggaaagactttgagccctatgactttactctggatgactaa
Sequence Length
1617
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,537 Da
NCBI Official Full Name
Homo sapiens CWF19-like 1, cell cycle control (S. pombe), mRNA
NCBI Official Synonym Full Names
CWF19-like 1, cell cycle control (S. pombe)
NCBI Official Symbol
CWF19L1
NCBI Official Synonym Symbols
C19L1; hDrn1; SCAR17
NCBI Protein Information
CWF19-like protein 1
UniProt Protein Name
CWF19-like protein 1
Protein Family
UniProt Gene Name
CWF19L1
UniProt Synonym Gene Names
C19L1
UniProt Entry Name
C19L1_HUMAN

NCBI Description

This gene encodes a member of the CWF19 protein family. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia-17 and mild mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Uniprot Description

CWF19L1: Belongs to the CWF19 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 10q24.31

Disease: Spinocerebellar Ataxia, Autosomal Recessive 17

Research Articles on CWF19L1

Similar Products

Product Notes

The CWF19L1 cwf19l1 (Catalog #AAA1275805) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcacaga aaccgctgcg cctcttggct tgtggagatg ttgaaggaaa gtttgatatt ttattcaata gagttcaagc aattcagaag aaaagtggaa actttgatct gctgttgtgt gtaggaaatt tctttggctc cacccaagat gctgaatggg aggagtataa gactggcatc aagaaagttc ctattcagac atatgtgctt ggtgctaata accaggaaac agtaaaatat ttccaggatg ctgatggatg tgaattagct gaaaacatta cttatctggg tcgtaaaggt atcttcactg gaagctcggg gctgcagatt gtgtacctca gtgggacaga atccttaaat gagccagtac caggttatag ttttagtccc aaggatgtgt cttctctgag aatgatgctg tgtacaacct cccagtttaa gggtgttgat atcttgctca catccccatg gcccaagtgt gtggggaact ttgggaattc ttctggagaa gtggatacca aaaaatgtgg ttctgctttg gtttccagtc ttgccacggg cttgaaacca agataccatt ttgctgcttt ggaaaagacc tattatgaga ggcttccata tcgaaaccat atcattctac aggaaaatgc acagcatgcc acccggttta tagctctggc aaatgttgga aatccagaaa agaaaaagta tctttacgcg ttcagtattg ttcccatgaa gctaatggat gcagcagaac tggtaaaaca gcctccggat gtcactgaaa acccttacag aaaatctggg caggaagcat ccataggaaa gcaaattctt gcccctgtgg aagaatcagc ctgtcagttt ttctttgatt taaatgaaaa gcagggaagg aagcgttcat ccacaggtag agatagcaaa tcttctcctc atccaaagca gcctcgcaaa cctcctcagc ctccaggacc ctgctggttt tgccttgcta gccctgaagt ggaaaaacat ttggtggtca acatcggcac acattgctac cttgccctgg ccaaaggagg cttatctgat gaccatgtcc tcatcctgcc tattggacac taccagtcag tggtggagct ttcagcagag gtggtagaag aggtggagaa gtataaggcc actctgagac ggttctttaa gagtcgaggg aaatggtgtg ttgtatttga gagaaattat aagagccatc acctccagct acaggtcatt cctgtcccaa tcagctgctc tactactgat gacattaaag atgccttcat tacccaggca caggagcagc agatagagct gttggaaatc ccagagcact ctgacatcaa gcagattgca cagccaggag cagcatattt ttatgttgaa cttgacacag gagaaaagct tttccacaga attaaaaaga attttccttt gcagtttgga agggaggtcc tggccagtga agccatcctt aatgttcctg ataagtctga ctggaggcag tgtcagatca gcaaggaaga cgaggagacc ctggctcgcc gcttccggaa agactttgag ccctatgact ttactctgga tgactaa. It is sometimes possible for the material contained within the vial of "CWF19L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.