Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CTRC cdna clone

CTRC cDNA Clone

Gene Names
CTRC; CLCR; ELA4
Synonyms
CTRC; CTRC cDNA Clone; CTRC cdna clone
Ordering
For Research Use Only!
Sequence
atgttgggcatcactgtcctcgctgcgctcttggcctgtgcctccagctgtggggtgcccagcttcccgcccaacctatccgcccgagtggtgggaggagaggatgcccggccccacagctggccctggcagatctccctccagtacctcaagaacgacacgtggaggcatacgtgtggcgggactttgattgctagcaacttcgtcctcactgccgcccactgcatcagcaacacccggacctaccgtgtggccgtgggaaagaacaacctggaggtggaagacgaagaaggatccctgtttgtgggtgtggacaccatccacgtccacaagagatggaatgccctcctgttgcgcaatgatattgccctcatcaagcttgcagagcatgtggagctgagtgacaccatccaggtggcctgcctgccagagaaggactccctgctccccaaggactacccctgctatgtcaccggctggggccgcctctggaccaacggccccattgctgataagctgcagcagggcctgcagcccgtggtggatcacgccacgtgctccaggattgactggtggggcttcagggtgaagaaaaccatggtgtgcgctgggggcgatggcgtcatctcagcctgcaatggggactccggtggcccactgaactgccagttggagaacggttcctgggaggtgtttggcatcgtcagctttggctcccggcggggctgcaacacccgcaagaagccggtagtctacacccgggtgtccgcctacatcgactggatcaacgagaaaatgcagctgtga
Sequence Length
807
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,484 Da
NCBI Official Full Name
Homo sapiens chymotrypsin C (caldecrin), mRNA
NCBI Official Synonym Full Names
chymotrypsin C
NCBI Official Symbol
CTRC
NCBI Official Synonym Symbols
CLCR; ELA4
NCBI Protein Information
chymotrypsin-C
UniProt Protein Name
Chymotrypsin-C
Protein Family
UniProt Gene Name
CTRC
UniProt Synonym Gene Names
CLCR
UniProt Entry Name
CTRC_HUMAN

NCBI Description

This gene encodes a member of the peptidase S1 family. The encoded protein is a serum calcium-decreasing factor that has chymotrypsin-like protease activity. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

CTRC: Has chymotrypsin-type protease activity and hypocalcemic activity. Genetic variations in CTRC can predispose to chronic pancreatitis by diminishing its protective trypsin-degrading activity. Belongs to the peptidase S1 family. Elastase subfamily.

Protein type: EC 3.4.21.2; Protease

Chromosomal Location of Human Ortholog: 1p36.21

Cellular Component: extracellular region

Molecular Function: peptidase activity; protein binding

Biological Process: cobalamin metabolic process

Disease: Pancreatitis, Hereditary

Research Articles on CTRC

Similar Products

Product Notes

The CTRC ctrc (Catalog #AAA1276130) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgggca tcactgtcct cgctgcgctc ttggcctgtg cctccagctg tggggtgccc agcttcccgc ccaacctatc cgcccgagtg gtgggaggag aggatgcccg gccccacagc tggccctggc agatctccct ccagtacctc aagaacgaca cgtggaggca tacgtgtggc gggactttga ttgctagcaa cttcgtcctc actgccgccc actgcatcag caacacccgg acctaccgtg tggccgtggg aaagaacaac ctggaggtgg aagacgaaga aggatccctg tttgtgggtg tggacaccat ccacgtccac aagagatgga atgccctcct gttgcgcaat gatattgccc tcatcaagct tgcagagcat gtggagctga gtgacaccat ccaggtggcc tgcctgccag agaaggactc cctgctcccc aaggactacc cctgctatgt caccggctgg ggccgcctct ggaccaacgg ccccattgct gataagctgc agcagggcct gcagcccgtg gtggatcacg ccacgtgctc caggattgac tggtggggct tcagggtgaa gaaaaccatg gtgtgcgctg ggggcgatgg cgtcatctca gcctgcaatg gggactccgg tggcccactg aactgccagt tggagaacgg ttcctgggag gtgtttggca tcgtcagctt tggctcccgg cggggctgca acacccgcaa gaagccggta gtctacaccc gggtgtccgc ctacatcgac tggatcaacg agaaaatgca gctgtga. It is sometimes possible for the material contained within the vial of "CTRC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.