CTDSP2 cdna clone
CTDSP2 cDNA Clone
Gene Names
CTDSP2; OS4; PSR2; SCP2
Synonyms
CTDSP2; CTDSP2 cDNA Clone; CTDSP2 cdna clone
Sequence
atggaacacggctccatcatcacccaggcgcggagggaagacgccctggtgctcaccaagcaaggcctggtctccaagtcctctcctaagaagcctcgtggacgtaacatcttcaaggcccttttctgctgttttcgcgcccagcatgttggccagtcaagttcctccactgagctcgctgcgtataaggaggaagcaaacaccattgctaagtcggatctgctccagtgtctccagtaccagttctaccagatcccagggacctgcctgctcccagaggtgacagaggaagatcaaggaaggatctgtgtggtcattgacctcgatgaaacccttgtgcatagctcctttaagccaatcaacaatgctgacttcatagtgcctatagagattgaggggaccactcaccaggtgtatgtgctcaagaggccttatgtggatgagttcctgagacgcatgggggaactctttgaatgtgttctcttcactgccagcctggccaagtatgccgaccctgtgacagacctgctggaccggtgtggggtgttccgggcccgcctattccgtgagtcttgcgtgttccaccagggctgctacgtcaaggacctcagccgcctggggagggacctgagaaagaccctcatcctggacaactcgcctgcttcttacatattccaccccgagaatgcagtgcctgtgcagtcctggtttgatgacatggcagacactgagttgctgaacctgatcccaatctttgaggagctgagcggagcagaggacgtctacaccagccttgggcagctgcgggccccttag
Sequence Length
816
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,664 Da
NCBI Official Full Name
Homo sapiens CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2, mRNA
NCBI Official Synonym Full Names
CTD small phosphatase 2
NCBI Official Symbol
CTDSP2
NCBI Official Synonym Symbols
OS4; PSR2; SCP2
NCBI Protein Information
carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 2
UniProt Protein Name
Carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 2
UniProt Gene Name
CTDSP2
UniProt Synonym Gene Names
NIF2; OS4; SCP2; NLI-interacting factor 2; SCP2
UniProt Entry Name
CTDS2_HUMAN
Uniprot Description
CTDSP2: Preferentially catalyzes the dephosphorylation of 'Ser- 5' within the tandem 7 residues repeats in the C-terminal domain (CTD) of the largest RNA polymerase II subunit POLR2A. Negatively regulates RNA polymerase II transcription, possibly by controlling the transition from initiation/capping to processive transcript elongation. Recruited by REST to neuronal genes that contain RE-1 elements, leading to neuronal gene silencing in non-neuronal cells. May contribute to the development of sarcomas.
Protein type: Phosphatase; EC 3.1.3.16; Nuclear receptor co-regulator
Chromosomal Location of Human Ortholog: 12q14.1
Cellular Component: nucleoplasm
Molecular Function: CTD phosphatase activity; protein binding
Biological Process: protein amino acid dephosphorylation
Research Articles on CTDSP2
Similar Products
Product Notes
The CTDSP2 ctdsp2 (Catalog #AAA1267042) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacacg gctccatcat cacccaggcg cggagggaag acgccctggt gctcaccaag caaggcctgg tctccaagtc ctctcctaag aagcctcgtg gacgtaacat cttcaaggcc cttttctgct gttttcgcgc ccagcatgtt ggccagtcaa gttcctccac tgagctcgct gcgtataagg aggaagcaaa caccattgct aagtcggatc tgctccagtg tctccagtac cagttctacc agatcccagg gacctgcctg ctcccagagg tgacagagga agatcaagga aggatctgtg tggtcattga cctcgatgaa acccttgtgc atagctcctt taagccaatc aacaatgctg acttcatagt gcctatagag attgagggga ccactcacca ggtgtatgtg ctcaagaggc cttatgtgga tgagttcctg agacgcatgg gggaactctt tgaatgtgtt ctcttcactg ccagcctggc caagtatgcc gaccctgtga cagacctgct ggaccggtgt ggggtgttcc gggcccgcct attccgtgag tcttgcgtgt tccaccaggg ctgctacgtc aaggacctca gccgcctggg gagggacctg agaaagaccc tcatcctgga caactcgcct gcttcttaca tattccaccc cgagaatgca gtgcctgtgc agtcctggtt tgatgacatg gcagacactg agttgctgaa cctgatccca atctttgagg agctgagcgg agcagaggac gtctacacca gccttgggca gctgcgggcc ccttag. It is sometimes possible for the material contained within the vial of "CTDSP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
