Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CRTAM cdna clone

CRTAM cDNA Clone

Gene Names
CRTAM; CD355
Synonyms
CRTAM; CRTAM cDNA Clone; CRTAM cdna clone
Ordering
For Research Use Only!
Sequence
atgtggtggagagttctcagcttgctggcatggttccccttgcaagaggcctctctgactaaccacacagaaaccatcaccgtggaggaaggccagacgctcactctaaagtgtgtcacttctctgaggaagaactcctccctccagtggctgaccccctcagggttcaccatttttttaaatgagtatcctgttttaaaaaattccaaataccagcttcttcatcactcggccaatcagctctccatcactgtgcctaacgtaaccctgcaagatgaaggcgtgtacaagtgcttacattacagcgactctgtaagcacaaaggaagtgaaagtgattgtgctggcaactcctttcaagccaatcctggaagcttcagttatcagaaagcaaaatggagaagaacatgttgtactcatgtgctccaccatgagaagcaagccccctccgcagataacctggctacttgggaatagcatggaagtgtccggtggaacgctccatgaatttgaaactgatgggaagaaatgtaatactaccagcactctcataatccacacttatggcaaaaattcaacggtggactgcattatccgacacagaggcctgcaagggagaaaactagtagcacccttccggtttgaagatttggttactgatgaagagacagcttcagatgctctggagagaaactctctatcctctcaagacccacagcagcccaccagtactgtctcagtaacggaagattctagtacatcggagattgacaaggaagagaaagaacaaaccactcaagatcctgacttgaccaccgaagcaaatcctcagtatttaggactggcaagaaagaaaagtggcatcctgctgctcacgctggtgtccttcctcattttcatactcttcatcatagtccagctcttcatcatgaagctgaggaaaacacatgtgatatggaagaaagaaaacgaagtttcagaacacacactagaaagttacagatcaaggtcaaataatgaagaaacatcatctgaagagaaaaatggccaatcttcccaccctatgcgttgcatgaactacatcacaaagttgtactcagaaggaaaaacaaagaggaaggaaaatgtacaacattcaaaattagaagaaaagcacatccaagtaccagagagtattgtgtag
Sequence Length
1182
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,256 Da
NCBI Official Full Name
Homo sapiens cytotoxic and regulatory T cell molecule, mRNA
NCBI Official Synonym Full Names
cytotoxic and regulatory T-cell molecule
NCBI Official Symbol
CRTAM
NCBI Official Synonym Symbols
CD355
NCBI Protein Information
cytotoxic and regulatory T-cell molecule
UniProt Protein Name
Cytotoxic and regulatory T-cell molecule
UniProt Gene Name
CRTAM
UniProt Entry Name
CRTAM_HUMAN

NCBI Description

The CRTAM gene is upregulated in CD4 (see MIM 186940)-positive and CD8 (see CD8A; MIM 186910)-positive T cells and encodes a type I transmembrane protein with V and C1-like Ig domains (Yeh et al., 2008 [PubMed 18329370]).[supplied by OMIM, Feb 2009]

Uniprot Description

CRTAM: Interaction with CADM1 promotes natural killer (NK) cell cytotoxicity and interferon-gamma (IFN-gamma) secretion by CD8+ cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM3 in vivo. Belongs to the nectin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Apoptosis

Chromosomal Location of Human Ortholog: 11q24.1

Cellular Component: cell-cell adherens junction; integral to plasma membrane; plasma membrane

Molecular Function: cell adhesion molecule binding; protein homodimerization activity; receptor activity; receptor binding

Biological Process: activated T cell proliferation; cell recognition; detection of stimulus; detection of tumor cell; heterophilic cell adhesion; homophilic cell adhesion; positive regulation of cytokine secretion; positive regulation of natural killer cell mediated cytotoxicity; positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target; regulation of immune response; T cell mediated cytotoxicity

Research Articles on CRTAM

Similar Products

Product Notes

The CRTAM crtam (Catalog #AAA1277485) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggtgga gagttctcag cttgctggca tggttcccct tgcaagaggc ctctctgact aaccacacag aaaccatcac cgtggaggaa ggccagacgc tcactctaaa gtgtgtcact tctctgagga agaactcctc cctccagtgg ctgaccccct cagggttcac cattttttta aatgagtatc ctgttttaaa aaattccaaa taccagcttc ttcatcactc ggccaatcag ctctccatca ctgtgcctaa cgtaaccctg caagatgaag gcgtgtacaa gtgcttacat tacagcgact ctgtaagcac aaaggaagtg aaagtgattg tgctggcaac tcctttcaag ccaatcctgg aagcttcagt tatcagaaag caaaatggag aagaacatgt tgtactcatg tgctccacca tgagaagcaa gccccctccg cagataacct ggctacttgg gaatagcatg gaagtgtccg gtggaacgct ccatgaattt gaaactgatg ggaagaaatg taatactacc agcactctca taatccacac ttatggcaaa aattcaacgg tggactgcat tatccgacac agaggcctgc aagggagaaa actagtagca cccttccggt ttgaagattt ggttactgat gaagagacag cttcagatgc tctggagaga aactctctat cctctcaaga cccacagcag cccaccagta ctgtctcagt aacggaagat tctagtacat cggagattga caaggaagag aaagaacaaa ccactcaaga tcctgacttg accaccgaag caaatcctca gtatttagga ctggcaagaa agaaaagtgg catcctgctg ctcacgctgg tgtccttcct cattttcata ctcttcatca tagtccagct cttcatcatg aagctgagga aaacacatgt gatatggaag aaagaaaacg aagtttcaga acacacacta gaaagttaca gatcaaggtc aaataatgaa gaaacatcat ctgaagagaa aaatggccaa tcttcccacc ctatgcgttg catgaactac atcacaaagt tgtactcaga aggaaaaaca aagaggaagg aaaatgtaca acattcaaaa ttagaagaaa agcacatcca agtaccagag agtattgtgt ag. It is sometimes possible for the material contained within the vial of "CRTAM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.