CPSF4 cdna clone

CPSF4 cDNA Clone

Cat. Num. AAA1273839

• Gene Names: CPSF4; NAR; NEB1; NEB-1; CPSF30
• Synonyms: CPSF4; CPSF4 cDNA Clone; CPSF4 cdna clone

• Sequence: atgcaggaaatcatcgccagcgtggaccacatcaagtttgacttggagatcgcggtggagcagcagctgggggcgcagccgctgcccttccccggcatggacaagtcgggcgctgctgtctgtgaattctttttgaaagctgcctgcggcaaagggggcatgtgtccgtttcgccacatcagtggtgagaagacagttgtgtgcaaacactggctgcgtggcctatgcaagaaaggggaccagtgtgagttcctgcatgagtatgacatgaccaagatgcccgagtgctacttctactccaagttcggggagtgcagcaacaaggaatgtcccttcctgcacatcgaccccgagtccaagatcaaggactgtccttggtatgaccgcggcttctgcaagcacggtcccctctgcaggcaccggcacacacggagagtcatctgtgtgaattacctcgtgggattctgcccggaggggccctcgtgtaaattcatgcaccctcgatttgaactgcccatgggaaccaccgagcagcccccactgccacagcagacacagcctccagcaaagagaaccccgcaggtcatcggggtcatgcagagtcaaaacagcagcgcgggcaaccggggaccccggccactggagcaggtcacctgttacaagtgtggcgagaaaggacactacgccaacagatgcaccaaagggcacttggcctttctcagtggacagtga
• Sequence Length: 732

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 29792108
• NCBI GeneID: 10898
• Molecular Weight: 27,419 Da
• NCBI Official Full Name: Homo sapiens cleavage and polyadenylation specific factor 4, 30kDa, mRNA
• NCBI Official Synonym Full Names: cleavage and polyadenylation specific factor 4
• NCBI Official Symbol: CPSF4
• NCBI Official Synonym Symbols: NAR; NEB1; NEB-1; CPSF30
• NCBI Protein Information: cleavage and polyadenylation specificity factor subunit 4
• UniProt Protein Name: Cleavage and polyadenylation specificity factor subunit 4
• Protein Family: Cleavage and polyadenylation specificity factor
• UniProt Gene Name: CPSF4
• UniProt Synonym Gene Names: CPSF30; NAR; NEB1; CPSF 30 kDa subunit; Neb-1
• UniProt Entry Name: CPSF4_HUMAN

NCBI Description

Inhibition of the nuclear export of poly(A)-containing mRNAs caused by the influenza A virus NS1 protein requires its effector domain. The NS1 effector domain functionally interacts with the cellular 30 kDa subunit of cleavage and polyadenylation specific factor 4, an essential component of the 3' end processing machinery of cellular pre-mRNAs. In influenza virus-infected cells, the NS1 protein is physically associated with cleavage and polyadenylation specific factor 4, 30kD subunit. Binding of the NS1 protein to the 30 kDa protein in vitro prevents CPSF binding to the RNA substrate and inhibits 3' end cleavage and polyadenylation of host pre-mRNAs. Thus the NS1 protein selectively inhibits the nuclear export of cellular, and not viral, mRNAs. Multiple alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CPSF4: Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other factors to bring about cleavage and poly(A) addition. CPSF4 binds RNA polymers with a preference for poly(U). Belongs to the CPSF4/YTH1 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA processing; Mitochondrial

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: mRNA cleavage and polyadenylation specificity factor complex; nucleoplasm

Molecular Function: protein binding

Biological Process: modification by virus of host mRNA processing; tRNA splicing