Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CPSF3L cdna clone

CPSF3L cDNA Clone

Gene Names
CPSF3L; RC68; INT11; RC-68; INTS11; CPSF73L
Synonyms
CPSF3L; CPSF3L cDNA Clone; CPSF3L cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgagatcagagtcacgcccttgggggccggccaggacgtgggccgaagctgcatcctggtctccattgcgggcaagaatgtcatgctggactgtggaatgcacatgggcttcaatgacgaccgacgcttccctgacttctcctacatcacccagaacggccgcctaacagacttcctggactgtgtgatcattagccacttccacctggaccactgcggggcactcccctacttcagcgagatggtgggctacgacggccccatctacatgactcaccccacccaggccatctgccccatcttgctggaggactaccgcaagatcgccgtagacaagaagggcgaggccaacttcttcacctcccagatgatcaaagactgcatcctcctggagaccttctgggagcgcatgaacctgaaggtgcccatctacttctccacggggctgaccgagaaggccaaccactactacaagctgttcatcccctggaccaaccagaagatccgcaagacttttgtgcagaggaacatgtttgagttcaagcacatcaaggccttcgaccgggcttttgctgacaacccaggaccgatggttgtgtttgccacgccaggaatgctgcacgctgggcagtccctgcagatcttccggaaatgggccggaaacgaaaagaacatggtcatcatgcccggctactgcgtgcagggcaccgtcggccacaagatcctcagcgggcagcggaagctcgagatggaggggcggcaggtgctggaggtcaagatgcaggtggagtacatgtcattcagcgcacacgcggacgccaagggcatcatgcagctggtgtcctcagagcaagccctcaaagagctgggtctggctgagcaccagctgcgcttcacctgccgcgtgcacctgcatgacacacgcaaggagcaggagacggcattgcgcgtctacagccacctcaagagcgtcctgaaggaccactgtgtgcagcacctcccggacggctctgtgactgtggagtccgtcctcctccaggccgccgccccttctgaggacccaggcaccaaggtgctgctggtctcctggacctaccaggacgaggagctggggagcttcctcacatctctgctgaagaagggcctcccccaggcccccagctga
Sequence Length
1170
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,147 Da
NCBI Official Full Name
Homo sapiens cleavage and polyadenylation specific factor 3-like, mRNA
NCBI Official Synonym Full Names
cleavage and polyadenylation specific factor 3-like
NCBI Official Symbol
CPSF3L
NCBI Official Synonym Symbols
RC68; INT11; RC-68; INTS11; CPSF73L
NCBI Protein Information
integrator complex subunit 11
UniProt Protein Name
Integrator complex subunit 11
UniProt Gene Name
CPSF3L
UniProt Synonym Gene Names
INTS11; RC68; Int11; CPSF3-like protein; RC-68
UniProt Entry Name
INT11_HUMAN

NCBI Description

The Integrator complex contains at least 12 subunits and associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates the 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690). INTS11, or CPSF3L, is the catalytic subunit of the Integrator complex (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Uniprot Description

INTS11: Catalytic component of the Integrator complex, a complex involved in the small nuclear RNAs (snRNA) U1 and U2 transcription and in their 3'-box-dependent processing. The Integrator complex is associated with the C-terminal domain (CTD) of RNA polymerase II largest subunit (POLR2A) and is recruited to the U1 and U2 snRNAs genes. Mediates the snRNAs 3' cleavage. Belongs to the metallo-beta-lactamase superfamily. RNA-metabolizing metallo-beta-lactamase-like family. INTS11 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Ribonuclease; RNA processing; EC 3.1.27.-

Chromosomal Location of Human Ortholog: 1p36.33

Cellular Component: integrator complex; nucleoplasm

Molecular Function: protein binding

Biological Process: snRNA processing; snRNA transcription from RNA polymerase II promoter

Research Articles on CPSF3L

Similar Products

Product Notes

The CPSF3L cpsf3l (Catalog #AAA1277123) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgaga tcagagtcac gcccttgggg gccggccagg acgtgggccg aagctgcatc ctggtctcca ttgcgggcaa gaatgtcatg ctggactgtg gaatgcacat gggcttcaat gacgaccgac gcttccctga cttctcctac atcacccaga acggccgcct aacagacttc ctggactgtg tgatcattag ccacttccac ctggaccact gcggggcact cccctacttc agcgagatgg tgggctacga cggccccatc tacatgactc accccaccca ggccatctgc cccatcttgc tggaggacta ccgcaagatc gccgtagaca agaagggcga ggccaacttc ttcacctccc agatgatcaa agactgcatc ctcctggaga ccttctggga gcgcatgaac ctgaaggtgc ccatctactt ctccacgggg ctgaccgaga aggccaacca ctactacaag ctgttcatcc cctggaccaa ccagaagatc cgcaagactt ttgtgcagag gaacatgttt gagttcaagc acatcaaggc cttcgaccgg gcttttgctg acaacccagg accgatggtt gtgtttgcca cgccaggaat gctgcacgct gggcagtccc tgcagatctt ccggaaatgg gccggaaacg aaaagaacat ggtcatcatg cccggctact gcgtgcaggg caccgtcggc cacaagatcc tcagcgggca gcggaagctc gagatggagg ggcggcaggt gctggaggtc aagatgcagg tggagtacat gtcattcagc gcacacgcgg acgccaaggg catcatgcag ctggtgtcct cagagcaagc cctcaaagag ctgggtctgg ctgagcacca gctgcgcttc acctgccgcg tgcacctgca tgacacacgc aaggagcagg agacggcatt gcgcgtctac agccacctca agagcgtcct gaaggaccac tgtgtgcagc acctcccgga cggctctgtg actgtggagt ccgtcctcct ccaggccgcc gccccttctg aggacccagg caccaaggtg ctgctggtct cctggaccta ccaggacgag gagctgggga gcttcctcac atctctgctg aagaagggcc tcccccaggc ccccagctga. It is sometimes possible for the material contained within the vial of "CPSF3L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.