Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COQ7 cdna clone

COQ7 cDNA Clone

Gene Names
COQ7; CAT5; CLK1; CLK-1; COQ10D8
Synonyms
COQ7; COQ7 cDNA Clone; COQ7 cdna clone
Ordering
For Research Use Only!
Sequence
atgagttgcgccggggcggcggcggctccccgcctttggcggctgcgcccgggggcccggcggtccctctcagcttatggaagaagaaccagtgtcagatttcgcagttcaggaatgactttagacaatatcagtcgggcagctgtggatcgaataatccgggtggatcatgcaggcgaatatggagcaaaccgcatctatgccgggcagatggctgtcctgggtcggaccagcgtcgggccagtcattcagaaaatgtgggatcaagaaaaggaccatttgaaaaagttcaatgagttgatggttacgttcagggtccggccaacagttctgatgcccttgtggaacgtgctggggtttgcactgggggcggggaccgccttgctcgggaaggaaggtgccatggcctgcaccgtggcggtggaagagagcatagcacatcactacaacaaccagatcaggacgctgatggaggaggaccctgaaaaatacgaggaacttcttcagctgataaagaaatttcgggatgaagagcttgagcaccatgacataggcctcgaccatgatgcagaattggctccagcctatgccgtcctgaagagcattatccaggccggatgcagagtggcgatatatttatcagaaagattataa
Sequence Length
654
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,158 Da
NCBI Official Full Name
Homo sapiens coenzyme Q7 homolog, ubiquinone (yeast), mRNA
NCBI Official Synonym Full Names
coenzyme Q7, hydroxylase
NCBI Official Symbol
COQ7
NCBI Official Synonym Symbols
CAT5; CLK1; CLK-1; COQ10D8
NCBI Protein Information
5-demethoxyubiquinone hydroxylase, mitochondrial
UniProt Protein Name
5-demethoxyubiquinone hydroxylase, mitochondrial
UniProt Gene Name
COQ7
UniProt Synonym Gene Names
DMQ hydroxylase
UniProt Entry Name
COQ7_HUMAN

NCBI Description

The protein encoded by this gene is similar to a mitochondrial di-iron containing hydroxylase in Saccharomyces cerevisiae that is involved with ubiquinone biosynthesis. Mutations in the yeast gene lead to slower development and longer life span. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]

Uniprot Description

COQ7: Involved in lifespan determination in ubiquinone- independent manner. Involved in ubiquinone biosynthesis. Potential central metabolic regulator. Belongs to the COQ7 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cofactor and Vitamin Metabolism - ubiquinone and other terpenoid-quinone biosynthesis; Mitochondrial

Chromosomal Location of Human Ortholog: 16p12.3

Cellular Component: nucleus

Molecular Function: protein binding

Disease: Coenzyme Q10 Deficiency, Primary, 8

Research Articles on COQ7

Similar Products

Product Notes

The COQ7 coq7 (Catalog #AAA1266411) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagttgcg ccggggcggc ggcggctccc cgcctttggc ggctgcgccc gggggcccgg cggtccctct cagcttatgg aagaagaacc agtgtcagat ttcgcagttc aggaatgact ttagacaata tcagtcgggc agctgtggat cgaataatcc gggtggatca tgcaggcgaa tatggagcaa accgcatcta tgccgggcag atggctgtcc tgggtcggac cagcgtcggg ccagtcattc agaaaatgtg ggatcaagaa aaggaccatt tgaaaaagtt caatgagttg atggttacgt tcagggtccg gccaacagtt ctgatgccct tgtggaacgt gctggggttt gcactggggg cggggaccgc cttgctcggg aaggaaggtg ccatggcctg caccgtggcg gtggaagaga gcatagcaca tcactacaac aaccagatca ggacgctgat ggaggaggac cctgaaaaat acgaggaact tcttcagctg ataaagaaat ttcgggatga agagcttgag caccatgaca taggcctcga ccatgatgca gaattggctc cagcctatgc cgtcctgaag agcattatcc aggccggatg cagagtggcg atatatttat cagaaagatt ataa. It is sometimes possible for the material contained within the vial of "COQ7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.