Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COL20A1 cdna clone

COL20A1 cDNA Clone

Gene Names
COL20A1; bA261N11.4
Synonyms
COL20A1; COL20A1 cDNA Clone; COL20A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagctccggagaccctgcacacctcggcctctgcctctggctgtggctgggcgccaccctgggaagagagcaagttcaagcaagcggtctcctgaggctggctgtgctgcctgaggaccggctgcagatgaagtggagagagtcggaggggagcggcctcggctacctggtgcaggtgaagcccatggcaggggactcggaacaggaggtgatactgaccaccaagacccctaaggccacagtggggggcctgagcccctccaagggctacaccttgcagatcttcgagctcactggctctgggcgcttcctgctagctcggagggagtttgtgattgaggatctgaagagtagctccctggacaggagcagccagaggcccctcggctctggagccccggagcccaccccctcccacacggggagcccagaccctgagcaggcttctgagccccaagttgccttcacaccaagccaggatccgcgcactcctgccggcccccagttccgctgcctgccccccgtgcctgctgacatggtcttcctggtggacgggtcctggagcattggccacagtcacttccagcaggtcaaggacttcctggccagtgtcatcgcaccctttgaaatcgggccggataaggtccaagtaggcctgactcagtacagcggggatgctcagactgagtgggacctgaactccctcagcaccaaggaacaggtgctggcagctgtgcgccgcctccgctacaagggggggaacacgttcacaggccttgccctgacccacgtgctggggcagaacctgcagccggcggctggcctccgtccagaggcagccaaggtggtgattctggtgacggacggcaagtcccaggacgatgtgcacactgctgcccgtgtcctcaaggacctgggcgtgaacgtcttcgctgtgggtgtgaagaacgccgatgaggctgagctgaggctcctggcgtccccgccgagggacatcaccgtccacagcgtgctggacttcctgcagctcggcgcgctggctggcctgctcagccgtctcatctgccagaggctccagggtgggagcccgcggcagggcccagcagcagcggctccagccctggacaccctccctgcccccaccagcctggtcctgagccaggtgacctcctccagcatccgcctgtcctggactccagccccccggcaccccctcaagtatctgatcgtttggcgagcctctagaggtggcacccccagggaggtggtggtggaggggcccgccgcctccacggagctgcacaacctggcctcccgcacagagtacctggtctccgtgttccccatctatgagggcggggttggcgaaggcctgcggggcctggtgaccacagcacctctgcctccgccccgggcgctgaccctggccgcagtgacgcccagaaccgtccacctcacctggcagccctcggccggggccacccactacctggtgcgatgttctcctgcttcccccaagggtgaagaggaggagcgagaggtgcaggtcgggcggcccgaggtgctgctggatggcctggaacctggcagggactatgaggtctcggtgcagagcctgcgaggccctgagggcagcgaggcccggggcatccgtgccaggacccccaccctggcccccccgagacacctgggcttctcagacgtgagccacgacgcggcacgagtgttctgggagggtgccccgaggcctgtgcgcctggtcagggtcacctatgtgtccagcgagggtggacactcggggcagaggctcctgggaacgccacctcggccacgctggggcctctctcttcctccaccacctacactgtccgtgtcacctgcctctaccctgggggtggctcctctacgctga
Sequence Length
1914
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
138,781 Da
NCBI Official Full Name
Homo sapiens collagen, type XX, alpha 1, mRNA
NCBI Official Synonym Full Names
collagen type XX alpha 1 chain
NCBI Official Symbol
COL20A1
NCBI Official Synonym Symbols
bA261N11.4
NCBI Protein Information
collagen alpha-1(XX) chain
UniProt Protein Name
Collagen alpha-1(XX) chain
Protein Family
UniProt Gene Name
COL20A1
UniProt Synonym Gene Names
KIAA1510
UniProt Entry Name
COKA1_HUMAN

Uniprot Description

COL20A1: Probable collagen protein. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 20q13.33

Cellular Component: endoplasmic reticulum lumen; extracellular matrix; extracellular region

Similar Products

Product Notes

The COL20A1 col20a1 (Catalog #AAA1268336) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctccg gagaccctgc acacctcggc ctctgcctct ggctgtggct gggcgccacc ctgggaagag agcaagttca agcaagcggt ctcctgaggc tggctgtgct gcctgaggac cggctgcaga tgaagtggag agagtcggag gggagcggcc tcggctacct ggtgcaggtg aagcccatgg caggggactc ggaacaggag gtgatactga ccaccaagac ccctaaggcc acagtggggg gcctgagccc ctccaagggc tacaccttgc agatcttcga gctcactggc tctgggcgct tcctgctagc tcggagggag tttgtgattg aggatctgaa gagtagctcc ctggacagga gcagccagag gcccctcggc tctggagccc cggagcccac cccctcccac acggggagcc cagaccctga gcaggcttct gagccccaag ttgccttcac accaagccag gatccgcgca ctcctgccgg cccccagttc cgctgcctgc cccccgtgcc tgctgacatg gtcttcctgg tggacgggtc ctggagcatt ggccacagtc acttccagca ggtcaaggac ttcctggcca gtgtcatcgc accctttgaa atcgggccgg ataaggtcca agtaggcctg actcagtaca gcggggatgc tcagactgag tgggacctga actccctcag caccaaggaa caggtgctgg cagctgtgcg ccgcctccgc tacaaggggg ggaacacgtt cacaggcctt gccctgaccc acgtgctggg gcagaacctg cagccggcgg ctggcctccg tccagaggca gccaaggtgg tgattctggt gacggacggc aagtcccagg acgatgtgca cactgctgcc cgtgtcctca aggacctggg cgtgaacgtc ttcgctgtgg gtgtgaagaa cgccgatgag gctgagctga ggctcctggc gtccccgccg agggacatca ccgtccacag cgtgctggac ttcctgcagc tcggcgcgct ggctggcctg ctcagccgtc tcatctgcca gaggctccag ggtgggagcc cgcggcaggg cccagcagca gcggctccag ccctggacac cctccctgcc cccaccagcc tggtcctgag ccaggtgacc tcctccagca tccgcctgtc ctggactcca gccccccggc accccctcaa gtatctgatc gtttggcgag cctctagagg tggcaccccc agggaggtgg tggtggaggg gcccgccgcc tccacggagc tgcacaacct ggcctcccgc acagagtacc tggtctccgt gttccccatc tatgagggcg gggttggcga aggcctgcgg ggcctggtga ccacagcacc tctgcctccg ccccgggcgc tgaccctggc cgcagtgacg cccagaaccg tccacctcac ctggcagccc tcggccgggg ccacccacta cctggtgcga tgttctcctg cttcccccaa gggtgaagag gaggagcgag aggtgcaggt cgggcggccc gaggtgctgc tggatggcct ggaacctggc agggactatg aggtctcggt gcagagcctg cgaggccctg agggcagcga ggcccggggc atccgtgcca ggacccccac cctggccccc ccgagacacc tgggcttctc agacgtgagc cacgacgcgg cacgagtgtt ctgggagggt gccccgaggc ctgtgcgcct ggtcagggtc acctatgtgt ccagcgaggg tggacactcg gggcagaggc tcctgggaac gccacctcgg ccacgctggg gcctctctct tcctccacca cctacactgt ccgtgtcacc tgcctctacc ctgggggtgg ctcctctacg ctga. It is sometimes possible for the material contained within the vial of "COL20A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.