Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COL1A1 cdna clone

COL1A1 cDNA Clone

Gene Names
COL1A1; OI1; OI2; OI3; OI4; EDSC
Synonyms
COL1A1; COL1A1 cDNA Clone; COL1A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcagctttgtggacctccggctcctgctcctcttagcggccaccgccctcctgacgcacggccaagaggaaggccaagtcgagggccaagacgaagacatcccaccaatcacctgcgtacagaacggcctcaggtaccatgaccgagacgtgtggaaacccgagccctgccggatctgcgtctgcgacaacggcaaggtgttgtgcgatgacgtgatctgtgacgagaccaagaactgccccggcgccgaagtccccgagggcgagtgctgtcccgtctgccccgacggctcagagtcacccaccgaccaagaaaccaccggcgtcgagggacccaagggagacactggcccccgaggcccaaggggacccgcaggcccccctggccgagatggcatccctggacagcctggacttcccggaccccccggaccccccggacctcccggaccccctggcctcggaggaaactttgctccccagctgtcttatggctatgatgagaaatcaaccggaggaatttccgtgcctggccccatgggtccctctggtcctcgtggtctccctggcccccctggtgcacctggtccccaaggcttccaaggtccccctggtgagcctggcgagcctggagcttcaggtcccatgggtccccgaggtcccccaggtccccctggaaagaatggagatgatggggaagctggaaaacctggtcgtcctggtgagcgtgggcctcctgggcctcagggtgctcgaggattgcccggaacagctggcctccctggaatgaagggacacagaggtttcagtggtttggatggtgccaagggagatgctggtcctgctggtcctaagggtgagcctggcagccctggtgaaaatggagctcctggtcagatgggcccccgtggcctgcctggtgagagaggtcgccctggagcccctggccctgctggtgctcgtggaaatgatggtgctactggtgctgccgggccccctggtcccaccggccccgctggtcctcctggcttccctggtgctgttggtgctaagggtgaagctggtccccaagggccccgaggctctgaaggtccccagggtgtgcgtggtgagcctggcccccctggccctgctggtgctgctggccctgctggaaaccctggtgctgatggacagcctggtgctaaaggtgccaatggtgctcctggtattgctggtgctcctggcttccctggtgcccgaggcccctctggaccccagggccccggcggccctcctggtcccaagggtaacagcggtgaacctggtgctcctggcagcaaaggagacactggtgctaagggagagcctggccctgttggtgttcaaggaccccctggccctgctggagaggaaggaaagcgaggagctcgaggtgaacccggacccactggcctgcccggaccccctggcgagcgtggtggacctggtagccgtggtttccctggcgcagatggtgttgctggtcccaagggtcccgctggtgaacgtggttctcctggccctgctggccccaaaggatctcctggtgaagctggtcgtcccggtgaagctggtctgcctggtgccaagggtctgactggaagccctggcagccctggtcctgatggcaaaactggcccccctggtcccgccggtcaagatggtcgccccggacccccaggcccacctggtgcccgtggtcaggctggtgtgatgggattccctggacctaaaggtgctgctggagagcccggcaaggctggagagcgaggtgttcccggaccccctggcgctgtcggtcctgctggcaaagatggagaggctggagctcagggaccccctggccctgctggtcccgctggcgagagaggtgaacaaggccctgctggctcccccggattccagggtctccctggtcctgctggtcctccaggtgaagcaggcaaacctggtgaacagggtgttcctggagaccttggcgcccctggcccctctggagcaagaggcgagagaggtttccctggcgagcgtggtgtgcaaggtccccctggtcctgctggtccccgaggggccaacggtgctcccggcaacgatggtgctaagggtgatgctggtgcccctggagctcccggtagccagggcgcccctggccttcagggaatgcctggtgaacgtggtgcagctggtcttccagggcctaagggtgacagaggtgatgctggtcccaaaggtgctgatggctctcctggcaaagatggcgtccgtggtctgaccggccccattggtcctcctggccctgctggtgcccctggtgacaagggtgaaagtggtcccagcggccctgctggtcccactggagctcgtggtgcccccggagaccgtggtgagcctggtccccccggccctgctggctttgctggcccccctggtgctgacggccaacctggtgctaaaggcgaacctggtgatgctggtgctaaaggcgatgctggtccccctggccctgccggacccgctggaccccctggccccattggtaatgttggtgctcctggagccaaaggtgctcgcggcagcgctggtccccctggtgctactggtttccctggtgctgctggccgagtcggtcctcctggcccctctggaaatgctggaccccctggccctcctggtcctgctggcaaagaaggcggcaaaggtccccgtggtgagactggccctgctggacgtcctggtgaagttggtccccctggtccccctggccctgctggcgagaaaggatcccctggtgctgatggtcctgctggtgctcctggtactcccgggcctcaaggtattgctggacagcgtggtgtggtcggcctgcctggtcagagaggagagagaggcttccctggtcttcctggcccctctggtgaacctggcaaacaaggtccctctggagcaagtggtgaacgtggtccccctggtcccatgggcccccctggattggctggaccccctggtgaatctggacgtgagggggctcctggtgccgaaggttcccctggacgagacggttctcctggcgccaagggtgaccgtggtgagaccggccccgctggaccccctggtgctcctggtgctcctggtgcccctggccccgttggccctgctggcaagagtggtgatcgtggtgagactggtcctgctggtcccgccggtcctgtcggccctgttggcgcccgtggccccgccggaccccaaggcccacgtggtgacaagggtgagacaggcgaacagggcgacagaggcataaagggtcaccgtggcttctctggcctccagggtccccctggccctcctggctctcctggtgaacaaggtccctctggagcctctggtcctgctggtccccgaggtccccctggctctgctggtgctcctggcaaagatggactcaacggtctccctggccccattgggccccctggtcctcgcggtcgcactggtgatgctggtcctgttggtccccccggccctcctggacctcctggtccccctggtcctcccagcgctggtttcgacttcagcttcctgccccagccacctcaagagaaggctcacgatggtggccgctactaccgggctgatgatgccaatgtggttcgtgaccgtgacctcgaggtggacaccaccctcaagagcctgagccagcagatcgagaacatccggagcccagagggcagccgcaagaaccccgcccgcacctgccgtgacctcaagatgtgccactctgactggaagagtggagagtactggattgaccccaaccaaggctgcaacctggatgccatcaaagtcttctgcaacatggagactggtgagacctgcgtgtaccccactcagcccagtgtggcccagaagaactggtacatcagcaagaaccccaaggacaagaggcatgtctggttcggcgagagcatgaccgatggattccagttcgagtatggcggccagggctccgaccctgccgatgtggccatccagctgaccttcctgcgcctgatgtccaccgaggcctcccagaacatcacctaccactgcaagaacagcgtggcctacatggaccagcagactggcaacctcaagaaggccctgctcctccagggctccaacgagatcgagatccgcgccgagggcaacagccgcttcacctacagcgtcactgtcgatggctgcacgagtcacaccggagcctggggcaagacagtgattgaatacaaaaccaccaagacctcccgcctgcgcatcatcgatgtggcccccttggacgttggtgccccagaccaggaattcggcttcgacgttggccatgtctgcttcctgtaa
Sequence Length
4395
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
138,941 Da
NCBI Official Full Name
Homo sapiens collagen, type I, alpha 1, mRNA
NCBI Official Synonym Full Names
collagen type I alpha 1 chain
NCBI Official Symbol
COL1A1
NCBI Official Synonym Symbols
OI1; OI2; OI3; OI4; EDSC
NCBI Protein Information
collagen alpha-1(I) chain
UniProt Protein Name
Collagen alpha-1(I) chain
Protein Family
UniProt Gene Name
COL1A1
UniProt Entry Name
CO1A1_HUMAN

NCBI Description

This gene encodes the pro-alpha1 chains of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIA, Ehlers-Danlos syndrome Classical type, Caffey Disease and idiopathic osteoporosis. Reciprocal translocations between chromosomes 17 and 22, where this gene and the gene for platelet-derived growth factor beta are located, are associated with a particular type of skin tumor called dermatofibrosarcoma protuberans, resulting from unregulated expression of the growth factor. Two transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]

Uniprot Description

COL1A1: Type I collagen is a member of group I collagen (fibrillar forming collagen). Defects in COL1A1 are the cause of Caffey disease (CAFFD); also known as infantile cortical hyperostosis. Caffey disease is characterized by an infantile episode of massive subperiosteal new bone formation that typically involves the diaphyses of the long bones, mandible, and clavicles. The involved bones may also appear inflamed, with painful swelling and systemic fever often accompanying the illness. The bone changes usually begin before 5 months of age and resolve before 2 years of age. Defects in COL1A1 are a cause of Ehlers-Danlos syndrome type 1 (EDS1); also known as Ehlers-Danlos syndrome gravis. EDS is a connective tissue disorder characterized by hyperextensible skin, atrophic cutaneous scars due to tissue fragility and joint hyperlaxity. EDS1 is the severe form of classic Ehlers-Danlos syndrome. Defects in COL1A1 are the cause of Ehlers-Danlos syndrome type 7A (EDS7A); also known as autosomal dominant Ehlers-Danlos syndrome type VII. EDS is a connective tissue disorder characterized by hyperextensible skin, atrophic cutaneous scars due to tissue fragility and joint hyperlaxity. EDS7A is marked by bilateral congenital hip dislocation, hyperlaxity of the joints, and recurrent partial dislocations. Defects in COL1A1 are a cause of osteogenesis imperfecta type 1 (OI1). A dominantly inherited connective tissue disorder characterized by bone fragility and blue sclerae. Osteogenesis imperfecta type 1 is non-deforming with normal height or mild short stature, and no dentinogenesis imperfecta. Defects in COL1A1 are a cause of osteogenesis imperfecta type 2 (OI2); also known as osteogenesis imperfecta congenita. A connective tissue disorder characterized by bone fragility, with many perinatal fractures, severe bowing of long bones, undermineralization, and death in the perinatal period due to respiratory insufficiency. Defects in COL1A1 are a cause of osteogenesis imperfecta type 3 (OI3). A connective tissue disorder characterized by progressively deforming bones, very short stature, a triangular face, severe scoliosis, grayish sclera, and dentinogenesis imperfecta. Defects in COL1A1 are a cause of osteogenesis imperfecta type 4 (OI4); also known as osteogenesis imperfecta with normal sclerae. A connective tissue disorder characterized by moderately short stature, mild to moderate scoliosis, grayish or white sclera and dentinogenesis imperfecta. Genetic variations in COL1A1 are a cause of susceptibility to osteoporosis (OSTEOP); also known as involutional or senile osteoporosis or postmenopausal osteoporosis. Osteoporosis is characterized by reduced bone mass, disruption of bone microarchitecture without alteration in the composition of bone. Osteoporotic bones are more at risk of fracture. A chromosomal aberration involving COL1A1 is found in dermatofibrosarcoma protuberans. Translocation t(17;22)(q22;q13) with PDGF. Belongs to the fibrillar collagen family.

Protein type: Secreted; Secreted, signal peptide; Extracellular matrix

Chromosomal Location of Human Ortholog: 17q21.33

Cellular Component: collagen type I; endoplasmic reticulum lumen; extracellular matrix; extracellular region; extracellular space

Molecular Function: identical protein binding; platelet-derived growth factor binding; protein binding

Biological Process: blood coagulation; blood vessel development; collagen biosynthetic process; collagen catabolic process; collagen fibril organization; embryonic skeletal development; extracellular matrix organization and biogenesis; leukocyte migration; platelet activation; positive regulation of cell migration; positive regulation of transcription, DNA-dependent; regulation of immune response; sensory perception of sound; skeletal development; skin morphogenesis; visual perception

Disease: Caffey Disease; Ehlers-danlos Syndrome, Type I; Ehlers-danlos Syndrome, Type Vii, Autosomal Dominant; Osteogenesis Imperfecta, Type I; Osteogenesis Imperfecta, Type Ii; Osteogenesis Imperfecta, Type Iii; Osteogenesis Imperfecta, Type Iv; Osteoporosis

Research Articles on COL1A1

Similar Products

Product Notes

The COL1A1 col1a1 (Catalog #AAA1269552) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcagct ttgtggacct ccggctcctg ctcctcttag cggccaccgc cctcctgacg cacggccaag aggaaggcca agtcgagggc caagacgaag acatcccacc aatcacctgc gtacagaacg gcctcaggta ccatgaccga gacgtgtgga aacccgagcc ctgccggatc tgcgtctgcg acaacggcaa ggtgttgtgc gatgacgtga tctgtgacga gaccaagaac tgccccggcg ccgaagtccc cgagggcgag tgctgtcccg tctgccccga cggctcagag tcacccaccg accaagaaac caccggcgtc gagggaccca agggagacac tggcccccga ggcccaaggg gacccgcagg cccccctggc cgagatggca tccctggaca gcctggactt cccggacccc ccggaccccc cggacctccc ggaccccctg gcctcggagg aaactttgct ccccagctgt cttatggcta tgatgagaaa tcaaccggag gaatttccgt gcctggcccc atgggtccct ctggtcctcg tggtctccct ggcccccctg gtgcacctgg tccccaaggc ttccaaggtc cccctggtga gcctggcgag cctggagctt caggtcccat gggtccccga ggtcccccag gtccccctgg aaagaatgga gatgatgggg aagctggaaa acctggtcgt cctggtgagc gtgggcctcc tgggcctcag ggtgctcgag gattgcccgg aacagctggc ctccctggaa tgaagggaca cagaggtttc agtggtttgg atggtgccaa gggagatgct ggtcctgctg gtcctaaggg tgagcctggc agccctggtg aaaatggagc tcctggtcag atgggccccc gtggcctgcc tggtgagaga ggtcgccctg gagcccctgg ccctgctggt gctcgtggaa atgatggtgc tactggtgct gccgggcccc ctggtcccac cggccccgct ggtcctcctg gcttccctgg tgctgttggt gctaagggtg aagctggtcc ccaagggccc cgaggctctg aaggtcccca gggtgtgcgt ggtgagcctg gcccccctgg ccctgctggt gctgctggcc ctgctggaaa ccctggtgct gatggacagc ctggtgctaa aggtgccaat ggtgctcctg gtattgctgg tgctcctggc ttccctggtg cccgaggccc ctctggaccc cagggccccg gcggccctcc tggtcccaag ggtaacagcg gtgaacctgg tgctcctggc agcaaaggag acactggtgc taagggagag cctggccctg ttggtgttca aggaccccct ggccctgctg gagaggaagg aaagcgagga gctcgaggtg aacccggacc cactggcctg cccggacccc ctggcgagcg tggtggacct ggtagccgtg gtttccctgg cgcagatggt gttgctggtc ccaagggtcc cgctggtgaa cgtggttctc ctggccctgc tggccccaaa ggatctcctg gtgaagctgg tcgtcccggt gaagctggtc tgcctggtgc caagggtctg actggaagcc ctggcagccc tggtcctgat ggcaaaactg gcccccctgg tcccgccggt caagatggtc gccccggacc cccaggccca cctggtgccc gtggtcaggc tggtgtgatg ggattccctg gacctaaagg tgctgctgga gagcccggca aggctggaga gcgaggtgtt cccggacccc ctggcgctgt cggtcctgct ggcaaagatg gagaggctgg agctcaggga ccccctggcc ctgctggtcc cgctggcgag agaggtgaac aaggccctgc tggctccccc ggattccagg gtctccctgg tcctgctggt cctccaggtg aagcaggcaa acctggtgaa cagggtgttc ctggagacct tggcgcccct ggcccctctg gagcaagagg cgagagaggt ttccctggcg agcgtggtgt gcaaggtccc cctggtcctg ctggtccccg aggggccaac ggtgctcccg gcaacgatgg tgctaagggt gatgctggtg cccctggagc tcccggtagc cagggcgccc ctggccttca gggaatgcct ggtgaacgtg gtgcagctgg tcttccaggg cctaagggtg acagaggtga tgctggtccc aaaggtgctg atggctctcc tggcaaagat ggcgtccgtg gtctgaccgg ccccattggt cctcctggcc ctgctggtgc ccctggtgac aagggtgaaa gtggtcccag cggccctgct ggtcccactg gagctcgtgg tgcccccgga gaccgtggtg agcctggtcc ccccggccct gctggctttg ctggcccccc tggtgctgac ggccaacctg gtgctaaagg cgaacctggt gatgctggtg ctaaaggcga tgctggtccc cctggccctg ccggacccgc tggaccccct ggccccattg gtaatgttgg tgctcctgga gccaaaggtg ctcgcggcag cgctggtccc cctggtgcta ctggtttccc tggtgctgct ggccgagtcg gtcctcctgg cccctctgga aatgctggac cccctggccc tcctggtcct gctggcaaag aaggcggcaa aggtccccgt ggtgagactg gccctgctgg acgtcctggt gaagttggtc cccctggtcc ccctggccct gctggcgaga aaggatcccc tggtgctgat ggtcctgctg gtgctcctgg tactcccggg cctcaaggta ttgctggaca gcgtggtgtg gtcggcctgc ctggtcagag aggagagaga ggcttccctg gtcttcctgg cccctctggt gaacctggca aacaaggtcc ctctggagca agtggtgaac gtggtccccc tggtcccatg ggcccccctg gattggctgg accccctggt gaatctggac gtgagggggc tcctggtgcc gaaggttccc ctggacgaga cggttctcct ggcgccaagg gtgaccgtgg tgagaccggc cccgctggac cccctggtgc tcctggtgct cctggtgccc ctggccccgt tggccctgct ggcaagagtg gtgatcgtgg tgagactggt cctgctggtc ccgccggtcc tgtcggccct gttggcgccc gtggccccgc cggaccccaa ggcccacgtg gtgacaaggg tgagacaggc gaacagggcg acagaggcat aaagggtcac cgtggcttct ctggcctcca gggtccccct ggccctcctg gctctcctgg tgaacaaggt ccctctggag cctctggtcc tgctggtccc cgaggtcccc ctggctctgc tggtgctcct ggcaaagatg gactcaacgg tctccctggc cccattgggc cccctggtcc tcgcggtcgc actggtgatg ctggtcctgt tggtcccccc ggccctcctg gacctcctgg tccccctggt cctcccagcg ctggtttcga cttcagcttc ctgccccagc cacctcaaga gaaggctcac gatggtggcc gctactaccg ggctgatgat gccaatgtgg ttcgtgaccg tgacctcgag gtggacacca ccctcaagag cctgagccag cagatcgaga acatccggag cccagagggc agccgcaaga accccgcccg cacctgccgt gacctcaaga tgtgccactc tgactggaag agtggagagt actggattga ccccaaccaa ggctgcaacc tggatgccat caaagtcttc tgcaacatgg agactggtga gacctgcgtg taccccactc agcccagtgt ggcccagaag aactggtaca tcagcaagaa ccccaaggac aagaggcatg tctggttcgg cgagagcatg accgatggat tccagttcga gtatggcggc cagggctccg accctgccga tgtggccatc cagctgacct tcctgcgcct gatgtccacc gaggcctccc agaacatcac ctaccactgc aagaacagcg tggcctacat ggaccagcag actggcaacc tcaagaaggc cctgctcctc cagggctcca acgagatcga gatccgcgcc gagggcaaca gccgcttcac ctacagcgtc actgtcgatg gctgcacgag tcacaccgga gcctggggca agacagtgat tgaatacaaa accaccaaga cctcccgcct gcgcatcatc gatgtggccc ccttggacgt tggtgcccca gaccaggaat tcggcttcga cgttggccat gtctgcttcc tgtaa. It is sometimes possible for the material contained within the vial of "COL1A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.