CNKSR3 cdna clone
CNKSR3 cDNA Clone
Gene Names
CNKSR3; MAGI1
Synonyms
CNKSR3; CNKSR3 cDNA Clone; CNKSR3 cdna clone
Sequence
atggaacccgtgaccaagtggagccccaaacaagtggtggactggactagagggttggatgactgcctgcaacaatatgtccacaagtttgaacgagagaagatcaacggcgagcagctgctgcagatttcccatcaggacctggaggagctgggggtcacacggatcggacaccaggagcttgtgttggaggctgtggaccttctctgtgcactgaattatggcctcgaaactgataacatgaagaacttggttctgaaactgagagcatcttcccacaatttacagaattacataagtagccgacggaaaagtcccgcttacgatggcaacacctcccgcaaggcccccaatgagttcctgacctcggtggtggagctcatcggcgccgccaaggccctgctggcgtggctggaccgggctccgtttacagggatcactgatttctcagtcacgaagaacaaaattatccagctttgcttggacctgaccactacagtccagaaggattgctttgtagcggaaatggaggataaagttttaactgtggtcaaggttttaaatggcatctgtgacaaaacaatccgatctaccacagatcctgtgatgagccagtgtgcatgtctggaggaagttcacttaccaaacattaaacctggggaaggcctgggcatgtacatcaaatcaacctatgatgggttacacgtgattactggaaccacagaaaattctcctgcagacagatctcagaagattcatgctggtgacgaagtcattcaagttaatcagcaaactgtggtgggatggcagctgaaaaatctggtgaagaaattgagagagaatcccaccggagttgtgttactgcttaagaagcgccccaccgggtctttcaactttactcctgctcccctgaaaaacctacggtggaagccacctcttgtacagacctcacctccacccgcgacaacccagtcccctgaaagcactatggatacctcactgaagaaggagaagtcagccatcctggatctttatattcctcctccgcctgctgttccctactctccccgggatgagaatggcagttttgtttatggagggtccagtaagtgcaaacaaccattgcctggtcctaagggttcagagtccccgaattccttcttggaccaggaaagccggagacgaagattcaccattgcagactcggatcagttgcctgggtactcggtggaaaccaacattctgcccacaaaaatgagagagaaaacaccatcttatggcaagccacggcctttgtccatgcctgctgatgggaactggatggggattgtggacccttttgccagacctcgaggtcatggcaggaaaggggaggatgccctttgccggtatttcagtaacgagcggattcctccgatcattgaagagagctcctctcccccataccggttctccagacccacgaccgagcggcatctggtccggggtgcggactacatccgaggaagcaggtgctacatcaactcagatctccacagcagcgccacgattccattccaggaggaagggaccaaaaagaaatctggctcctcagctacgaagtcctcgtccacagaaccgtccctcctggtcagctggtttacgcgcctcaaactgttgactcactga
Sequence Length
1668
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,904 Da
NCBI Official Full Name
Homo sapiens CNKSR family member 3, mRNA
NCBI Official Synonym Full Names
CNKSR family member 3
NCBI Official Symbol
CNKSR3
NCBI Official Synonym Symbols
MAGI1
NCBI Protein Information
connector enhancer of kinase suppressor of ras 3
UniProt Protein Name
Connector enhancer of kinase suppressor of ras 3
Protein Family
UniProt Gene Name
CNKSR3
UniProt Synonym Gene Names
MAGI1; Connector enhancer of KSR 3; CNK3
UniProt Entry Name
CNKR3_HUMAN
Uniprot Description
CNKSR3: Probably involved in transepithelial sodium transport. Regulates aldosterone-induced and ENaC-mediated sodium transport possibly through regulation of the ERK pathway. Belongs to the CNKSR family.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 6q25.2
Molecular Function: protein binding
Biological Process: negative regulation of peptidyl-serine phosphorylation
Research Articles on CNKSR3
Similar Products
Product Notes
The CNKSR3 cnksr3 (Catalog #AAA1275432) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacccg tgaccaagtg gagccccaaa caagtggtgg actggactag agggttggat gactgcctgc aacaatatgt ccacaagttt gaacgagaga agatcaacgg cgagcagctg ctgcagattt cccatcagga cctggaggag ctgggggtca cacggatcgg acaccaggag cttgtgttgg aggctgtgga ccttctctgt gcactgaatt atggcctcga aactgataac atgaagaact tggttctgaa actgagagca tcttcccaca atttacagaa ttacataagt agccgacgga aaagtcccgc ttacgatggc aacacctccc gcaaggcccc caatgagttc ctgacctcgg tggtggagct catcggcgcc gccaaggccc tgctggcgtg gctggaccgg gctccgttta cagggatcac tgatttctca gtcacgaaga acaaaattat ccagctttgc ttggacctga ccactacagt ccagaaggat tgctttgtag cggaaatgga ggataaagtt ttaactgtgg tcaaggtttt aaatggcatc tgtgacaaaa caatccgatc taccacagat cctgtgatga gccagtgtgc atgtctggag gaagttcact taccaaacat taaacctggg gaaggcctgg gcatgtacat caaatcaacc tatgatgggt tacacgtgat tactggaacc acagaaaatt ctcctgcaga cagatctcag aagattcatg ctggtgacga agtcattcaa gttaatcagc aaactgtggt gggatggcag ctgaaaaatc tggtgaagaa attgagagag aatcccaccg gagttgtgtt actgcttaag aagcgcccca ccgggtcttt caactttact cctgctcccc tgaaaaacct acggtggaag ccacctcttg tacagacctc acctccaccc gcgacaaccc agtcccctga aagcactatg gatacctcac tgaagaagga gaagtcagcc atcctggatc tttatattcc tcctccgcct gctgttccct actctccccg ggatgagaat ggcagttttg tttatggagg gtccagtaag tgcaaacaac cattgcctgg tcctaagggt tcagagtccc cgaattcctt cttggaccag gaaagccgga gacgaagatt caccattgca gactcggatc agttgcctgg gtactcggtg gaaaccaaca ttctgcccac aaaaatgaga gagaaaacac catcttatgg caagccacgg cctttgtcca tgcctgctga tgggaactgg atggggattg tggacccttt tgccagacct cgaggtcatg gcaggaaagg ggaggatgcc ctttgccggt atttcagtaa cgagcggatt cctccgatca ttgaagagag ctcctctccc ccataccggt tctccagacc cacgaccgag cggcatctgg tccggggtgc ggactacatc cgaggaagca ggtgctacat caactcagat ctccacagca gcgccacgat tccattccag gaggaaggga ccaaaaagaa atctggctcc tcagctacga agtcctcgtc cacagaaccg tccctcctgg tcagctggtt tacgcgcctc aaactgttga ctcactga. It is sometimes possible for the material contained within the vial of "CNKSR3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
