Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CNBP cdna clone

CNBP cDNA Clone

Gene Names
CNBP; DM2; ZNF9; CNBP1; PROMM; RNF163; ZCCHC22
Synonyms
CNBP; CNBP cDNA Clone; CNBP cdna clone
Ordering
For Research Use Only!
Sequence
atgagcagcaatgagtgcttcaagtgtggacgatctggccactgggcccgggaatgtcctactggtggaggccgtggtcgtggaatgagaagccgtggcagaggtttccagtttgtttcctcgtctcttccagatatttgttatcgctgtggtgagtctggtcatcttgccaaggattgtgatcttcaggaggatgcctgctataactgcggtagaggtggccacattgccaaggactgcaaggagcccaagagagagcgagagcaatgctgctacaactgtggcaaaccaggccatctggctcgtgactgcgaccatgcagatgagcagaaatgctattcttgtggagaattcggacacattcaaaaagactgcaccaaagtgaagtgctataggtgtggtgaaactggtcatgtagccatcaactgcagcaagacaagtgaagtcaactgttaccgctgtggcgagtcagggcaccttgcacgggaatgcacaattgaggctacagcctaa
Sequence Length
513
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,871 Da
NCBI Official Full Name
Homo sapiens CCHC-type zinc finger, nucleic acid binding protein, mRNA
NCBI Official Synonym Full Names
CCHC-type zinc finger nucleic acid binding protein
NCBI Official Symbol
CNBP
NCBI Official Synonym Symbols
DM2; ZNF9; CNBP1; PROMM; RNF163; ZCCHC22
NCBI Protein Information
cellular nucleic acid-binding protein
UniProt Protein Name
Cellular nucleic acid-binding protein
UniProt Gene Name
CNBP
UniProt Synonym Gene Names
RNF163; ZNF9; CNBP
UniProt Entry Name
CNBP_HUMAN

NCBI Description

This gene encodes a nucleic-acid binding protein with seven zinc-finger domains. The protein has a preference for binding single stranded DNA and RNA. The protein functions in cap-independent translation of ornithine decarboxylase mRNA, and may also function in sterol-mediated transcriptional regulation. A CCTG expansion from <30 repeats to 75-11000 repeats in the first intron of this gene results in myotonic dystrophy type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

Uniprot Description

ZNF9: Single stranded DNA-binding protein, with specificity to the sterol regulatory element (SRE). Involved in sterol-mediated repression. Defects in CNBP are the cause of dystrophia myotonica type 2 (DM2); also known as proximal myotonic myopathy (PROMM). A multisystem disease characterized by the association of proximal muscle weakness with myotonia, cardiac manifestations and cataract. Additional features can include hyperhidrosis, testicular atrophy, insulin resistance and diabetes and central nervous system anomalies in rare cases. The causative mutation is a CCTG expansion (mean approximately 5000 repeats) located in intron 1 of the CNBP gene. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 3q21

Cellular Component: cytosol; endoplasmic reticulum; nucleus

Molecular Function: protein binding; transcription factor activity

Biological Process: cholesterol biosynthetic process; positive regulation of cell proliferation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of transcription, DNA-dependent

Disease: Myotonic Dystrophy 2

Research Articles on CNBP

Similar Products

Product Notes

The CNBP cnbp (Catalog #AAA1274119) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcagca atgagtgctt caagtgtgga cgatctggcc actgggcccg ggaatgtcct actggtggag gccgtggtcg tggaatgaga agccgtggca gaggtttcca gtttgtttcc tcgtctcttc cagatatttg ttatcgctgt ggtgagtctg gtcatcttgc caaggattgt gatcttcagg aggatgcctg ctataactgc ggtagaggtg gccacattgc caaggactgc aaggagccca agagagagcg agagcaatgc tgctacaact gtggcaaacc aggccatctg gctcgtgact gcgaccatgc agatgagcag aaatgctatt cttgtggaga attcggacac attcaaaaag actgcaccaa agtgaagtgc tataggtgtg gtgaaactgg tcatgtagcc atcaactgca gcaagacaag tgaagtcaac tgttaccgct gtggcgagtc agggcacctt gcacgggaat gcacaattga ggctacagcc taa. It is sometimes possible for the material contained within the vial of "CNBP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.