CLYBL cdna clone
CLYBL cDNA Clone
Synonyms
CLYBL; CLYBL cDNA Clone; CLYBL cdna clone
Sequence
atggcgctacgtctgctgcggagggcggcgcgcggagctgcggcggcggcgctgctgaggctgaaagcgtctctagcagctgatatccccagacttggatatagttcctcatcccatcacaagtacatcccccggagggcagtgctttatgtacctggaaatgatgaaaagaaaataaagaagattccatccctgaatgtagattgtgcagtgctcgactgtgaggatggagtggctgcaaacaaaaagaatgaagctcgactgagaattgtaaaaactcttgaagacattgatctgggccctactgaaaaatgtgtgagagtcaactcagtttccagtggtctggcggaagaagacctagagacccttttgcaatcccgggtccttccttccagcctgatgctaccaaaggtggaaagtcctgaagaaatccagtggtttgcagacaaattttcattccacttaaaaggccgaaaacttgaacaaccaatgaatttaatcccttttgtggaaactgcaatgggtttgctcaattttaaggcagtgtgtgaagaaaccctgaaggtcgggcctcaagtaggtctctttctagatgcagtcgtttttggaggagaagactttcgagccagcataggtgcaacaagtagtaaagaaaccctggatattctctacgcccggcaaaagattgttgtcatagcgaaagcctttggtctccaagccgtagatctggtgtacattgactttcgagatggagctgggctgcttagacagtcacgagaaggagccgccatgggcttcactggtaagcaggtgattcaccctaaccaaattgccgtggtccaggagcagttttctccttcccctgaaaaaattaagtgggctgaagaactgattgctgcctttaaagaacatcaacaattaggaaagggggcctttactttccaagggagtatgatcgacatgccattactgaagcaggcccagaacactgttacgcttgccacctccatcaaggaaaaatga
Sequence Length
1023
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,409 Da
NCBI Official Full Name
Homo sapiens citrate lyase beta like, mRNA
UniProt Protein Name
Citrate lyase subunit beta-like protein, mitochondrial
UniProt Gene Name
CLYBL
UniProt Synonym Gene Names
CLB; Citrate lyase beta-like
UniProt Entry Name
CLYBL_HUMAN
Uniprot Description
CLYBL: Belongs to the HpcH/HpaI aldolase family. Citrate lyase beta subunit-like subfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 4.1.-.-; Mitochondrial; Lyase
Chromosomal Location of Human Ortholog: 13q32
Molecular Function: magnesium ion binding; malate synthase activity
Similar Products
Product Notes
The CLYBL clybl (Catalog #AAA1275659) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctac gtctgctgcg gagggcggcg cgcggagctg cggcggcggc gctgctgagg ctgaaagcgt ctctagcagc tgatatcccc agacttggat atagttcctc atcccatcac aagtacatcc cccggagggc agtgctttat gtacctggaa atgatgaaaa gaaaataaag aagattccat ccctgaatgt agattgtgca gtgctcgact gtgaggatgg agtggctgca aacaaaaaga atgaagctcg actgagaatt gtaaaaactc ttgaagacat tgatctgggc cctactgaaa aatgtgtgag agtcaactca gtttccagtg gtctggcgga agaagaccta gagacccttt tgcaatcccg ggtccttcct tccagcctga tgctaccaaa ggtggaaagt cctgaagaaa tccagtggtt tgcagacaaa ttttcattcc acttaaaagg ccgaaaactt gaacaaccaa tgaatttaat cccttttgtg gaaactgcaa tgggtttgct caattttaag gcagtgtgtg aagaaaccct gaaggtcggg cctcaagtag gtctctttct agatgcagtc gtttttggag gagaagactt tcgagccagc ataggtgcaa caagtagtaa agaaaccctg gatattctct acgcccggca aaagattgtt gtcatagcga aagcctttgg tctccaagcc gtagatctgg tgtacattga ctttcgagat ggagctgggc tgcttagaca gtcacgagaa ggagccgcca tgggcttcac tggtaagcag gtgattcacc ctaaccaaat tgccgtggtc caggagcagt tttctccttc ccctgaaaaa attaagtggg ctgaagaact gattgctgcc tttaaagaac atcaacaatt aggaaagggg gcctttactt tccaagggag tatgatcgac atgccattac tgaagcaggc ccagaacact gttacgcttg ccacctccat caaggaaaaa tga. It is sometimes possible for the material contained within the vial of "CLYBL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
