Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLEC4E cdna clone

CLEC4E cDNA Clone

Gene Names
CLEC4E; MINCLE; CLECSF9
Synonyms
CLEC4E; CLEC4E cDNA Clone; CLEC4E cdna clone
Ordering
For Research Use Only!
Sequence
atgaattcatctaaatcatctgaaacacaatgcacagagagaggatgcttctcttcccaaatgttcttatggactgttgctgggatccccatcctatttctcagtgcctgtttcatcaccagatgtgttgtgacatttcgcatctttcaaacctgtgatgagaaaaagtttcagctacctgagaatttcacagagctctcctgctacaattatggatcaggttcagtcaagaattgttgtccattgaactgggaatattttcaatccagctgctacttcttttctactgacaccatttcctgggcgttaagtttaaagaactgctcagccatgggggctcacctggtggttatcaactcacaggaggagcaggaattcctttcctacaagaaacctaaaatgagagagttttttattggactgtcagaccaggttgtcgagggtcagtggcaatgggtggacggcacacctttgacaaagtctctgagcttctgggatgtaggggagcccaacaacatagctaccctggaggactgtgccaccatgagagactcttcaaacccaaggcaaaattggaatgatgtaacctgtttcctcaattattttcggatttgtgaaatggtaggaataaatcctttgaacaaaggaaaatctctttaa
Sequence Length
660
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,073 Da
NCBI Official Full Name
Homo sapiens C-type lectin domain family 4, member E, mRNA
NCBI Official Synonym Full Names
C-type lectin domain family 4 member E
NCBI Official Symbol
CLEC4E
NCBI Official Synonym Symbols
MINCLE; CLECSF9
NCBI Protein Information
C-type lectin domain family 4 member E
UniProt Protein Name
C-type lectin domain family 4 member E
UniProt Gene Name
CLEC4E
UniProt Synonym Gene Names
CLECSF9; MINCLE
UniProt Entry Name
CLC4E_HUMAN

NCBI Description

This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein is a downstream target of CCAAT/enhancer binding protein (C/EBP), beta (CEBPB) and may play a role in inflammation. Alternative splice variants have been described but their full-length sequence has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]

Uniprot Description

CLEC4E: C-type lectin that functions as cell-surface receptor for a wide variety of ligands such as damaged cells, fungi and mycobacteria. Plays a role in the recognition of pathogenic fungi, such as Candida albicans. The detection of mycobacteria is via trehalose 6,6'-dimycolate (TDM), a cell wall glycolipid. Specifically recognizes alpha-mannose residues on pathogenic fungi of the genus Malassezia. Recognizes also SAP130, a nuclear protein, that is released by dead or dying cells. Transduces signals through an ITAM-containing adapter protein, Fc receptor gamma chain /FCER1G. Induces secretion of inflammatory cytokines through a pathway that depends on SYK, CARD9 and NF-kappa-B.

Protein type: Membrane protein, integral; Receptor, misc.

Chromosomal Location of Human Ortholog: 12p13.31

Cellular Component: plasma membrane

Biological Process: stimulatory C-type lectin receptor signaling pathway

Research Articles on CLEC4E

Similar Products

Product Notes

The CLEC4E clec4e (Catalog #AAA1276687) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattcat ctaaatcatc tgaaacacaa tgcacagaga gaggatgctt ctcttcccaa atgttcttat ggactgttgc tgggatcccc atcctatttc tcagtgcctg tttcatcacc agatgtgttg tgacatttcg catctttcaa acctgtgatg agaaaaagtt tcagctacct gagaatttca cagagctctc ctgctacaat tatggatcag gttcagtcaa gaattgttgt ccattgaact gggaatattt tcaatccagc tgctacttct tttctactga caccatttcc tgggcgttaa gtttaaagaa ctgctcagcc atgggggctc acctggtggt tatcaactca caggaggagc aggaattcct ttcctacaag aaacctaaaa tgagagagtt ttttattgga ctgtcagacc aggttgtcga gggtcagtgg caatgggtgg acggcacacc tttgacaaag tctctgagct tctgggatgt aggggagccc aacaacatag ctaccctgga ggactgtgcc accatgagag actcttcaaa cccaaggcaa aattggaatg atgtaacctg tttcctcaat tattttcgga tttgtgaaat ggtaggaata aatcctttga acaaaggaaa atctctttaa. It is sometimes possible for the material contained within the vial of "CLEC4E, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.