Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLASP1 cdna clone

CLASP1 cDNA Clone

Gene Names
CLASP1; MAST1
Synonyms
CLASP1; CLASP1 cDNA Clone; CLASP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagactctggaagcccacaaagactcccataaggaggtggtgagagcggctgaggaggctgcgtccacactggccagttccatccacccggagcagtgcatcaaggtgctctgccccatcatccagacggccgactaccccatcaaccttgctgccatcaagatgcagaccaaagtcgtcgagaggatcgcaaaggagtcattgctgcagctccttgtcgacatcatcccaggcttgctgcagggttatgacaacaccgaaagtagtgtgcgtaaggccagcgtgttttgcttagtggcaatttattccgtaatcggagaagacctgaaacctcaccttgcacagctcacagggagcaagatgaagctactaaacttatacataaagagggcccagaccaccaacagcaacagcagctcctcctccgatgtctccacgcacagctaa
Sequence Length
450
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
162,914 Da
NCBI Official Full Name
Homo sapiens cytoplasmic linker associated protein 1, mRNA
NCBI Official Synonym Full Names
cytoplasmic linker associated protein 1
NCBI Official Symbol
CLASP1
NCBI Official Synonym Symbols
MAST1
NCBI Protein Information
CLIP-associating protein 1
UniProt Protein Name
CLIP-associating protein 1
Protein Family
UniProt Gene Name
CLASP1
UniProt Synonym Gene Names
KIAA0622; MAST1; hOrbit1
UniProt Entry Name
CLAP1_HUMAN

NCBI Description

CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]).[supplied by OMIM, Mar 2008]

Uniprot Description

CLASP1: Microtubule plus-end tracking protein that promotes the stabilization of dynamic microtubules. Involved in the nucleation of noncentrosomal microtubules originating from the trans-Golgi network (TGN). Required for the polarization of the cytoplasmic microtubule arrays in migrating cells towards the leading edge of the cell. May act at the cell cortex to enhance the frequency of rescue of depolymerizing microtubules by attaching their plus-ends to cortical platforms composed of ERC1 and PHLDB2. This cortical microtubule stabilizing activity is regulated at least in part by phosphatidylinositol 3-kinase signaling. Also performs a similar stabilizing function at the kinetochore which is essential for the bipolar alignment of chromosomes on the mitotic spindle. Belongs to the CLASP family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q14.2-q14.3

Cellular Component: basal cortex; cell cortex; centrosome; cortical microtubule cytoskeleton; cytoplasmic microtubule; cytosol; focal adhesion; Golgi apparatus; kinetochore; kinetochore microtubule; membrane; spindle microtubule

Molecular Function: kinetochore binding; microtubule binding; microtubule plus-end binding; protein binding

Biological Process: astral microtubule organization and biogenesis; cell division; establishment of mitotic spindle localization; establishment of spindle orientation; exit from mitosis; G2/M transition of mitotic cell cycle; Golgi organization and biogenesis; microtubule bundle formation; microtubule cytoskeleton organization and biogenesis; microtubule nucleation; microtubule organizing center organization and biogenesis; mitotic spindle organization and biogenesis; negative regulation of microtubule depolymerization; negative regulation of microtubule polymerization or depolymerization; negative regulation of stress fiber formation; positive regulation of exocytosis; positive regulation of microtubule polymerization; regulation of focal adhesion formation; regulation of gastrulation; sister chromatid cohesion; vesicle targeting

Research Articles on CLASP1

Similar Products

Product Notes

The CLASP1 clasp1 (Catalog #AAA1274446) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagactc tggaagccca caaagactcc cataaggagg tggtgagagc ggctgaggag gctgcgtcca cactggccag ttccatccac ccggagcagt gcatcaaggt gctctgcccc atcatccaga cggccgacta ccccatcaac cttgctgcca tcaagatgca gaccaaagtc gtcgagagga tcgcaaagga gtcattgctg cagctccttg tcgacatcat cccaggcttg ctgcagggtt atgacaacac cgaaagtagt gtgcgtaagg ccagcgtgtt ttgcttagtg gcaatttatt ccgtaatcgg agaagacctg aaacctcacc ttgcacagct cacagggagc aagatgaagc tactaaactt atacataaag agggcccaga ccaccaacag caacagcagc tcctcctccg atgtctccac gcacagctaa. It is sometimes possible for the material contained within the vial of "CLASP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.