Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CIB3 cdna clone

CIB3 cDNA Clone

Gene Names
CIB3; KIP3
Synonyms
CIB3; CIB3 cDNA Clone; CIB3 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGGCAACAAGCAGACAGTCTTCACACACGAGCAGCTGGAAGCGTATCAGGACTGCACATTTTTCACAAGGAAGGAGATCATGAGGCTCTTCTATCGCTACCAGGACCTGGCCCCACAGCTCGTGCCCCTCGACTATACCACCTGCCCCGATGTGAAGGTGCCCTACGAGCTCATTGGCAGCATGCCCGAGCTGAAGGACAACCCCTTCCGCCAGAGGATTGCCCAGGTATTCTCTGAGGATGGGGATGGCCACATGACCCTGGACAACTTTTTGGACATGTTTTCCGTGATGAGTGAAATGGCTCCCCGCGACCTCAAGGCTTACTATGCTTTTAAAATTTATGATTTTAACAACGACGACTACATTTGTGCGTGGGACCTGGAGCAGACGGTGACCAAACTGACGCGGGGGGAGCTGAGTGCCGAGGAGGTGAGCCTGGTATGTGAGAAGGTGCTGGATGAGGCTGATGGAGACCATGATGGGCGGCTGTCCCTGGAAGATTTCCAGAACATGATCCTCCGGGCACCAGACTTCCTCAGCACCTTCCACATCCGAATCTGA
Sequence Length
564
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,974 Da
NCBI Official Full Name
Homo sapiens calcium and integrin binding family member 3, mRNA
NCBI Official Synonym Full Names
calcium and integrin binding family member 3
NCBI Official Symbol
CIB3
NCBI Official Synonym Symbols
KIP3
NCBI Protein Information
calcium and integrin-binding family member 3
UniProt Protein Name
Calcium and integrin-binding family member 3
UniProt Gene Name
CIB3
UniProt Synonym Gene Names
KIP3; KIP 3
UniProt Entry Name
CIB3_HUMAN

NCBI Description

This gene product shares a high degree of sequence similarity with DNA-dependent protein kinase catalytic subunit-interacting protein 2 in human and mouse, and like them may bind the catalytic subunit of DNA-dependent protein kinases. The exact function of this gene is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Uniprot Description

CIB3: Interacts with ITGA2B (via C-terminus cytoplasmic tail region); the interaction is stabilized/increased in a calcium and magnesium-dependent manner

Protein type: Calcium-binding

Chromosomal Location of Human Ortholog: 19p13.12

Molecular Function: calcium ion binding; magnesium ion binding; protein binding

Research Articles on CIB3

Similar Products

Product Notes

The CIB3 cib3 (Catalog #AAA1276921) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGGCAACA AGCAGACAGT CTTCACACAC GAGCAGCTGG AAGCGTATCA GGACTGCACA TTTTTCACAA GGAAGGAGAT CATGAGGCTC TTCTATCGCT ACCAGGACCT GGCCCCACAG CTCGTGCCCC TCGACTATAC CACCTGCCCC GATGTGAAGG TGCCCTACGA GCTCATTGGC AGCATGCCCG AGCTGAAGGA CAACCCCTTC CGCCAGAGGA TTGCCCAGGT ATTCTCTGAG GATGGGGATG GCCACATGAC CCTGGACAAC TTTTTGGACA TGTTTTCCGT GATGAGTGAA ATGGCTCCCC GCGACCTCAA GGCTTACTAT GCTTTTAAAA TTTATGATTT TAACAACGAC GACTACATTT GTGCGTGGGA CCTGGAGCAG ACGGTGACCA AACTGACGCG GGGGGAGCTG AGTGCCGAGG AGGTGAGCCT GGTATGTGAG AAGGTGCTGG ATGAGGCTGA TGGAGACCAT GATGGGCGGC TGTCCCTGGA AGATTTCCAG AACATGATCC TCCGGGCACC AGACTTCCTC AGCACCTTCC ACATCCGAAT CTGA. It is sometimes possible for the material contained within the vial of "CIB3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.