Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CIB2 cdna clone

CIB2 cDNA Clone

Gene Names
CIB2; KIP2; USH1J; DFNB48
Synonyms
CIB2; CIB2 cDNA Clone; CIB2 cdna clone
Ordering
For Research Use Only!
Sequence
atggggaacaagcagaccatcttcaccgaagagcagctagacaactaccaggactgcaccttcttcaataagaaggacatcctcaagctgcattcgcgattctatgagctggcccccaacctcgtcccaatggactacaggaagagccccatcgtccacgtgcccatgagcctcatcatccagatgccagagctccgggagaatcccttcaaagaaaggatcgtggcggcgttttccgaggatggtgaggggaacctcactttcaacgactttgtggacatgttttccgtgctctgcgagtcggctccccgagagctcaaggcaaactatgccttcaagatctatgacttcaacactgacaacttcatctgcaaggaggacctggagctgacgctggcccggctcactaagtcagagctggatgaggaggaggtggtgcttgtgtgcgacaaggtcattgaggaggctgacttggatggtgacggcaagctgggctttgctgacttcgaggacatgattgccaaggcccctgacttcctcagcactttccacatccggatctga
Sequence Length
564
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,816 Da
NCBI Official Full Name
Homo sapiens calcium and integrin binding family member 2, mRNA
NCBI Official Synonym Full Names
calcium and integrin binding family member 2
NCBI Official Symbol
CIB2
NCBI Official Synonym Symbols
KIP2; USH1J; DFNB48
NCBI Protein Information
calcium and integrin-binding family member 2
UniProt Protein Name
Calcium and integrin-binding family member 2
UniProt Gene Name
CIB2
UniProt Synonym Gene Names
KIP2; KIP 2
UniProt Entry Name
CIB2_HUMAN

NCBI Description

The protein encoded by this gene is similar to that of KIP/CIB, calcineurin B, and calmodulin. The encoded protein is a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs), and it is involved in photoreceptor cell maintenance. Mutations in this gene cause deafness, autosomal recessive, 48 (DFNB48), and also Usher syndrome 1J (USH1J). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Uniprot Description

CIB2: Critical for proper photorecetor cell maintenance and function. May play a role in calcium homeostasis and participate in calcium regulation in the mechanotransduction process

Protein type: Calcium-binding

Chromosomal Location of Human Ortholog: 15q24

Cellular Component: cytoplasm; photoreceptor inner segment; photoreceptor outer segment; stereocilium

Molecular Function: calcium ion binding; magnesium ion binding; protein binding; protein homodimerization activity

Biological Process: calcium ion homeostasis; elevation of cytosolic calcium ion concentration; photoreceptor cell maintenance

Disease: Deafness, Autosomal Recessive 48; Usher Syndrome, Type Ij

Research Articles on CIB2

Similar Products

Product Notes

The CIB2 cib2 (Catalog #AAA1277855) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaaca agcagaccat cttcaccgaa gagcagctag acaactacca ggactgcacc ttcttcaata agaaggacat cctcaagctg cattcgcgat tctatgagct ggcccccaac ctcgtcccaa tggactacag gaagagcccc atcgtccacg tgcccatgag cctcatcatc cagatgccag agctccggga gaatcccttc aaagaaagga tcgtggcggc gttttccgag gatggtgagg ggaacctcac tttcaacgac tttgtggaca tgttttccgt gctctgcgag tcggctcccc gagagctcaa ggcaaactat gccttcaaga tctatgactt caacactgac aacttcatct gcaaggagga cctggagctg acgctggccc ggctcactaa gtcagagctg gatgaggagg aggtggtgct tgtgtgcgac aaggtcattg aggaggctga cttggatggt gacggcaagc tgggctttgc tgacttcgag gacatgattg ccaaggcccc tgacttcctc agcactttcc acatccggat ctga. It is sometimes possible for the material contained within the vial of "CIB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.