Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CFP cdna clone

CFP cDNA Clone

Gene Names
CFP; BFD; PFC; PFD; PROPERDIN
Synonyms
CFP; CFP cDNA Clone; CFP cdna clone
Ordering
For Research Use Only!
Sequence
atgatcacagagggagcgcaggcccctcgattgttgctgccgccgctgctcctgctgctcaccctgccagccacaggctcagaccccgtgctctgcttcacccagtatgaagaatcctccggcaagtgcaagggcctcctggggggtggtgtcagcgtggaagactgctgtctcaacactgcctttgcctaccagaaacgtagtggtgggctctgtcagccttgcaggtccccacgatggtccctttggtccacatgggccccctgttcggtgacgtgctctgagggctcccagctgcggtaccggcgctgtgtgggctggaatgggcagtgctctggaaaggtggcacctgggaccctggagtggcagctccaggcctgtgaggaccagcagtgctgtcctgagatgggcggctggtctggctgggggccctgggagccttgctctgtcacctgctccaaagggacccggacccgcaggcgagcctgtaatcaccctgctcccaagtgtgggggccactgcccaggacaggcacaggaatcagaggcctgtgacacccagcaggtctgccccacacacggggcctgggccacctggggcccctggaccccctgctcagcctcctgccacggtggaccccacgaacctaaggagacacgaagccgcaagtgttctgcacctgagccctcccagaaacctcctgggaagccctgcccggggctagcctacgagcagcggaggtgcaccggcctgccaccctgcccagtggctgggggctgggggccttggggccctgtgagcccctgccctgtgacctgtggcctgggccagaccatggaacaacggacgtgcaatcaccctgtgccccagcatgggggccccttctgtgctggcgatgccacccggacccacatctgcaacacagctgtgccctgccctgtggatggggagtgggactcgtggggggagtggagcccctgtatccgacggaacatgaagtccatcagctgtcaagaaatcccgggccagcagtcacgcgggaggacctgcaggggccgcaagtttgacggacatcgatgtgccgggcaacagcaggatatccggcactgctacagcatccagcactgccccttgaaaggatcatggtcagagtggagtacctgggggctgtgcatgcccccctgtggacctaatcctacccgtgcccgccagcgcctctgcacacccttgctccccaagtacccgcccaccgtttccatggtcgaaggtcagggcgagaagaacgtgaccttctgggggagaccgctgccacggtgtgaggagctacaagggcagaagctggtggtggaggagaaacgaccatgtctacacgtgcctgcttgcaaagaccctgaggaagaggaactctaa
Sequence Length
1410
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,276 Da
NCBI Official Full Name
Homo sapiens complement factor properdin, mRNA
NCBI Official Synonym Full Names
complement factor properdin
NCBI Official Symbol
CFP
NCBI Official Synonym Symbols
BFD; PFC; PFD; PROPERDIN
NCBI Protein Information
properdin
UniProt Protein Name
Properdin
Protein Family
UniProt Gene Name
CFP
UniProt Synonym Gene Names
PFC
UniProt Entry Name
PROP_HUMAN

NCBI Description

This gene encodes a plasma glycoprotein that positively regulates the alternative complement pathway of the innate immune system. This protein binds to many microbial surfaces and apoptotic cells and stabilizes the C3- and C5-convertase enzyme complexes in a feedback loop that ultimately leads to formation of the membrane attack complex and lysis of the target cell. Mutations in this gene result in two forms of properdin deficiency, which results in high susceptibility to meningococcal infections. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Feb 2009]

Uniprot Description

CFP: A positive regulator of the alternate pathway of complement. It binds to and stabilizes the C3- and C5-convertase enzyme complexes. Defects in CFP are the cause of properdin deficiency (PFD). PFD results in higher susceptibility to bacterial infections; especially to meningococcal infections. Three phenotypes have been reported: complete deficiency (type I), incomplete deficiency (type II), and dysfunction of properdin (type III).

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: Xp11.4

Cellular Component: endoplasmic reticulum lumen; extracellular matrix; extracellular region; extracellular space

Biological Process: complement activation; complement activation, alternative pathway; defense response to bacterium; immune response; regulation of complement activation

Disease: Properdin Deficiency, X-linked

Research Articles on CFP

Similar Products

Product Notes

The CFP cfp (Catalog #AAA1274537) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcacag agggagcgca ggcccctcga ttgttgctgc cgccgctgct cctgctgctc accctgccag ccacaggctc agaccccgtg ctctgcttca cccagtatga agaatcctcc ggcaagtgca agggcctcct ggggggtggt gtcagcgtgg aagactgctg tctcaacact gcctttgcct accagaaacg tagtggtggg ctctgtcagc cttgcaggtc cccacgatgg tccctttggt ccacatgggc cccctgttcg gtgacgtgct ctgagggctc ccagctgcgg taccggcgct gtgtgggctg gaatgggcag tgctctggaa aggtggcacc tgggaccctg gagtggcagc tccaggcctg tgaggaccag cagtgctgtc ctgagatggg cggctggtct ggctgggggc cctgggagcc ttgctctgtc acctgctcca aagggacccg gacccgcagg cgagcctgta atcaccctgc tcccaagtgt gggggccact gcccaggaca ggcacaggaa tcagaggcct gtgacaccca gcaggtctgc cccacacacg gggcctgggc cacctggggc ccctggaccc cctgctcagc ctcctgccac ggtggacccc acgaacctaa ggagacacga agccgcaagt gttctgcacc tgagccctcc cagaaacctc ctgggaagcc ctgcccgggg ctagcctacg agcagcggag gtgcaccggc ctgccaccct gcccagtggc tgggggctgg gggccttggg gccctgtgag cccctgccct gtgacctgtg gcctgggcca gaccatggaa caacggacgt gcaatcaccc tgtgccccag catgggggcc ccttctgtgc tggcgatgcc acccggaccc acatctgcaa cacagctgtg ccctgccctg tggatgggga gtgggactcg tggggggagt ggagcccctg tatccgacgg aacatgaagt ccatcagctg tcaagaaatc ccgggccagc agtcacgcgg gaggacctgc aggggccgca agtttgacgg acatcgatgt gccgggcaac agcaggatat ccggcactgc tacagcatcc agcactgccc cttgaaagga tcatggtcag agtggagtac ctgggggctg tgcatgcccc cctgtggacc taatcctacc cgtgcccgcc agcgcctctg cacacccttg ctccccaagt acccgcccac cgtttccatg gtcgaaggtc agggcgagaa gaacgtgacc ttctggggga gaccgctgcc acggtgtgag gagctacaag ggcagaagct ggtggtggag gagaaacgac catgtctaca cgtgcctgct tgcaaagacc ctgaggaaga ggaactctaa. It is sometimes possible for the material contained within the vial of "CFP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.