Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CERK cdna clone

CERK cDNA Clone

Gene Names
CERK; LK4; hCERK; dA59H18.2; dA59H18.3
Synonyms
CERK; CERK cDNA Clone; CERK cdna clone
Ordering
For Research Use Only!
Sequence
atgcaacgtggccctgcttcaggtgatccgcgggaggggcctccacgccagcgccgggaaggctgctggggcctccacacctgcctcatcacggcggcgaggctacgacaatccggctgggagcatgaccttggcgtctgttctgggagcacggatgataagctctggaagctggcagtgtgtaaagcactggcaagtttgttactgttaaaatgtcaaataccaatgctttatatcgacgcgaagtgcttaacacagccgggcttgggggcagtcaggaggaagctggccatccgtggaggaggggccggtcctggactcccgcaggactcctctgaggcagggcctgaagtctgtacacgtggtccagatttgtccttgtcttttcttcacactgagttctctatatttattgaacatcttgtccttttaagccagagtagtgtaaactgcgtctcggatgtctgtcttttgcctcgaagccacgatggatcgctggtttcctctgcagcgcgagggctccggcgaccagaggattcttcccggaaggcattcctgccgcgctccccggggcacccctcaattgtgtactacgtccttgtttag
Sequence Length
606
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,781 Da
NCBI Official Full Name
Homo sapiens ceramide kinase, mRNA
NCBI Official Synonym Full Names
ceramide kinase
NCBI Official Symbol
CERK
NCBI Official Synonym Symbols
LK4; hCERK; dA59H18.2; dA59H18.3
NCBI Protein Information
ceramide kinase
UniProt Protein Name
Ceramide kinase
Protein Family
UniProt Gene Name
CERK
UniProt Synonym Gene Names
KIAA1646; hCERK; LK4
UniProt Entry Name
CERK1_HUMAN

NCBI Description

CERK converts ceramide to ceramide 1-phosphate (C1P), a sphingolipid metabolite. Both CERK and C1P have been implicated in various cellular processes, including proliferation, apoptosis, phagocytosis, and inflammation (Kim et al., 2006 [PubMed 16488390]).[supplied by OMIM, Mar 2008]

Uniprot Description

CERK: Catalyzes specifically the phosphorylation of ceramide to form ceramide 1-phosphate. Acts efficiently on natural and analog ceramides (C6, C8, C16 ceramides, and C8-dihydroceramide), to a lesser extent on C2-ceramide and C6-dihydroceramide, but not on other lipids, such as various sphingosines. Binds phosphoinositides.

Protein type: Kinase, lipid; Lipid Metabolism - sphingolipid; EC 2.7.1.138

Chromosomal Location of Human Ortholog: 22q13.31

Cellular Component: integral to membrane; plasma membrane

Molecular Function: ceramide kinase activity; magnesium ion binding; protein binding

Biological Process: ceramide metabolic process; glycosphingolipid metabolic process

Research Articles on CERK

Similar Products

Product Notes

The CERK cerk (Catalog #AAA1276692) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaacgtg gccctgcttc aggtgatccg cgggaggggc ctccacgcca gcgccgggaa ggctgctggg gcctccacac ctgcctcatc acggcggcga ggctacgaca atccggctgg gagcatgacc ttggcgtctg ttctgggagc acggatgata agctctggaa gctggcagtg tgtaaagcac tggcaagttt gttactgtta aaatgtcaaa taccaatgct ttatatcgac gcgaagtgct taacacagcc gggcttgggg gcagtcagga ggaagctggc catccgtgga ggaggggccg gtcctggact cccgcaggac tcctctgagg cagggcctga agtctgtaca cgtggtccag atttgtcctt gtcttttctt cacactgagt tctctatatt tattgaacat cttgtccttt taagccagag tagtgtaaac tgcgtctcgg atgtctgtct tttgcctcga agccacgatg gatcgctggt ttcctctgca gcgcgagggc tccggcgacc agaggattct tcccggaagg cattcctgcc gcgctccccg gggcacccct caattgtgta ctacgtcctt gtttag. It is sometimes possible for the material contained within the vial of "CERK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.