Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDKN2B cdna clone

CDKN2B cDNA Clone

Gene Names
CDKN2B; P15; MTS2; TP15; CDK4I; INK4B; p15INK4b
Synonyms
CDKN2B; CDKN2B cDNA Clone; CDKN2B cdna clone
Ordering
For Research Use Only!
Sequence
atgcgcgaggagaacaagggcatgcccagtgggggcggcagcgatgagggtctggccagcgccgcggcgcggggactagtggagaaggtgcgacagctcctggaagccggcgcggatcccaacggagtcaaccgtttcgggaggcgcgcgatccaggtcatgatgatgggcagcgcccgcgtggcggagctgctgctgctccacggcgcggagcccaactgcgcagaccctgccactctcacccgaccggtgcatgatgctgcccgggagggcttcctggacacgctggtggtgctgcaccgggccggggcgcggctggacgtgcgcgatgcctggggtcgtctgcccgtggacttggccgaggagcggggccaccgcgacgttgcagggtacctgcgcacagccacgggggactga
Sequence Length
417
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,078 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4), mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase inhibitor 2B
NCBI Official Symbol
CDKN2B
NCBI Official Synonym Symbols
P15; MTS2; TP15; CDK4I; INK4B; p15INK4b
NCBI Protein Information
cyclin-dependent kinase 4 inhibitor B
UniProt Protein Name
Cyclin-dependent kinase 4 inhibitor B
UniProt Gene Name
CDKN2B
UniProt Synonym Gene Names
MTS2; MTS-2; p15INK4B
UniProt Entry Name
CDN2B_HUMAN

NCBI Description

This gene lies adjacent to the tumor suppressor gene CDKN2A in a region that is frequently mutated and deleted in a wide variety of tumors. This gene encodes a cyclin-dependent kinase inhibitor, which forms a complex with CDK4 or CDK6, and prevents the activation of the CDK kinases, thus the encoded protein functions as a cell growth regulator that controls cell cycle G1 progression. The expression of this gene was found to be dramatically induced by TGF beta, which suggested its role in the TGF beta induced growth inhibition. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

p15-INK4B: a potent inhibitor that nteracts strongly with CDK4 and CDK6. Potential effector of TGF-beta induced cell cycle arrest.

Protein type: Protein kinase, regulatory subunit; Tumor suppressor; Cell cycle regulation; Inhibitor

Chromosomal Location of Human Ortholog: 9p21

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: cyclin-dependent protein kinase inhibitor activity; protein binding; protein kinase binding

Biological Process: cell cycle arrest; cellular response to extracellular stimulus; cellular response to nutrient; G2/M transition of mitotic cell cycle; megakaryocyte differentiation; mitotic cell cycle checkpoint; negative regulation of cell proliferation; negative regulation of epithelial cell proliferation; negative regulation of phosphorylation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transforming growth factor beta receptor signaling pathway; regulation of cyclin-dependent protein kinase activity

Research Articles on CDKN2B

Similar Products

Product Notes

The CDKN2B cdkn2b (Catalog #AAA1268966) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgcgagg agaacaaggg catgcccagt gggggcggca gcgatgaggg tctggccagc gccgcggcgc ggggactagt ggagaaggtg cgacagctcc tggaagccgg cgcggatccc aacggagtca accgtttcgg gaggcgcgcg atccaggtca tgatgatggg cagcgcccgc gtggcggagc tgctgctgct ccacggcgcg gagcccaact gcgcagaccc tgccactctc acccgaccgg tgcatgatgc tgcccgggag ggcttcctgg acacgctggt ggtgctgcac cgggccgggg cgcggctgga cgtgcgcgat gcctggggtc gtctgcccgt ggacttggcc gaggagcggg gccaccgcga cgttgcaggg tacctgcgca cagccacggg ggactga. It is sometimes possible for the material contained within the vial of "CDKN2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.