CDK1 cdna clone

CDK1

Cat. Num. AAA200626

• Gene Names: CDK1; CDC2; CDC28A; P34CDC2
• Synonyms: CDK1; CDC2; CDC28A; P34CDC2; CDK1 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGGAAGATTATACCAAAATAGAGAAAATTGGAGAAGGTACCTATGGAGTTGTGTATAAGGGTAGACACAAAACTACAGGTCAAGTGGTAGCCATGAAAAAAATCAGACTAGAAAGTGAAGAGGAAGGGGTTCCTAGTACTGCAATTCGGGAAATTTCTCTATTAAAGGAACTTCGTCATCCAAATATAGTCAGTCTTCAGGATGTGCTTATGCAGGATTCCAGGTTATATCTCATCTTTGAGTTTCTTTCCATGGATCTGAAGAAATACTTGGATTCTATCCCTCCTGGTCAGTACATGGATTCTTCACTTGTTAAGAGTTATTTATACCAAATCCTACAGGGGATTGTGTTTTGTCACTCTAGAAGAGTTCTTCACAGAGACTTAAAACCTCAAAATCTCTTGATTGATGACAAAGGAACAATTAAACTGGCTGATTTTGGCCTTGCCAGAGCTTTTGGAATACCTATCAGAGTATATACACATGAGGTAGTAACACTCTGGTACAGATCTCCAGAAGTATTGCTGGGGTCAGCTCGTTACTCAACTCCAGTTGACATTTGGAGTATAGGCACCATATTTGCTGAACTAGCAACTAAGAAACCACTTTTCCATGGGGATTCAGAAATTGATCAACTCTTCAGGATTTTCAGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATCTTTACAGGACTATAAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTGGATGAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCTGGCAAAATGGCACTGAATCATCCATATTTTAATGATTTGGACAATCAGATTAAGAAGATGTAG; ; Translation Sequence: MEDYTKIEKI GEGTYGVVYK GRHKTTGQVV AMKKIRLESE EEGVPSTAIR EISLLKELRH PNIVSLQDVL MQDSRLYLIF EFLSMDLKKY LDSIPPGQYM DSSLVKSYLY QILQGIVFCH SRRVLHRDLK PQNLLIDDKG TIKLADFGLA RAFGIPIRVY THEVVTLWYR SPEVLLGSAR YSTPVDIWSI GTIFAELATK KPLFHGDSEI DQLFRIFRAL GTPNNEVWPE VESLQDYKNT FPKWKPGSLA SHVKNLDENG LDLLSKMLIY DPAKRISGKM ALNHPYFNDL DNQIKKM
• Sequence Length: 297

• Species: Human
• Chromosome Location: 10q21.1
• OMIM Reference Number: 116940
• cDNA Size: 894bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for CDK1 cdna clone

The protein encoded by CDK1 is a member of the Ser/Thr protein kinase family. This protein is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with this protein and function as regulatory subunits. The kinase activity of this protein is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of this protein also play important regulatory roles in cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Product Categories/Family for CDK1 cdna clone

Cell Cycle

NCBI and Uniprot Product Information

• NCBI GI #: 4502709
• NCBI GeneID: 983
• NCBI Accession #: NP_001777.1
• NCBI GenBank Nucleotide #: NM_001786.4
• UniProt Accession #: P06493
• NCBI Official Full Name: cyclin-dependent kinase 1 isoform 1
• NCBI Official Synonym Full Names: cyclin dependent kinase 1
• NCBI Official Symbol: CDK1
• NCBI Official Synonym Symbols: CDC2; CDC28A; P34CDC2
• NCBI Protein Information: cyclin-dependent kinase 1
• UniProt Protein Name: Cyclin-dependent kinase 1
• UniProt Gene Name: CDK1
• UniProt Synonym Gene Names: CDC2; CDC28A; CDKN1; P34CDC2; CDK1
• UniProt Entry Name: CDK1_HUMAN

NCBI Description

The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with this protein and function as regulatory subunits. The kinase activity of this protein is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of this protein also play important regulatory roles in cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Uniprot Description

CDK1: a protein kinase of the CDK family. Catalytic subunit of the conserved protein complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions. Mitotic cyclins stably associate with this protein and function as regulatory subunits. Its activity is controlled by cyclin availability and phosphorylation through the cell cycle. Activated in many cancers including colon, liver and breast. The T isoform, which lacks a regulatory region, is expressed in breast cancer. Inhibition in cancer cells may drive cells into apoptosis. May also drive cell migration. Inhibitors: BMS-265246, BMS-265246-01. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.7.11.22; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; Motility/polarity/chemotaxis; Protein kinase, CMGC; EC 2.7.11.23; Cell cycle regulation; CMGC group; CDK family; CDK1 subfamily; CDK/CDK1 subfamily

Chromosomal Location of Human Ortholog: 10q21.1

Cellular Component: nucleoplasm; centrosome; membrane; mitochondrion; spindle microtubule; cytoplasm; midbody; cytosol; nucleus

Molecular Function: RNA polymerase subunit kinase activity; protein serine/threonine kinase activity; protein binding; cyclin binding; cyclin-dependent protein kinase activity; histone kinase activity; Hsp70 protein binding; ATP binding; protein kinase activity

Biological Process: regulation of Schwann cell differentiation; activation of MAPKK activity; nerve growth factor receptor signaling pathway; activation of MAPK activity; response to toxin; histone phosphorylation; ventricular cardiac muscle cell development; regulation of embryonic development; stress-activated MAPK cascade; centrosome cycle; toll-like receptor 3 signaling pathway; response to organic cyclic substance; toll-like receptor 5 signaling pathway; small GTPase mediated signal transduction; protein complex assembly; G2/M transition of mitotic cell cycle; toll-like receptor 4 signaling pathway; positive regulation of cardiac muscle cell proliferation; response to drug; mitosis; organ regeneration; fibroblast growth factor receptor signaling pathway; positive regulation of protein import into nucleus, translocation; cell aging; pronuclear fusion; toll-like receptor 2 signaling pathway; chromosome condensation; response to ethanol; cell division; toll-like receptor 9 signaling pathway; response to activity; G1/S transition of mitotic cell cycle; response to amine stimulus; negative regulation of apoptosis; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; axon guidance; apoptosis; mitotic nuclear envelope disassembly; positive regulation of mitotic cell cycle; toll-like receptor 10 signaling pathway; epithelial cell differentiation; anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; response to axon injury; DNA replication; epidermal growth factor receptor signaling pathway; cell migration; MyD88-independent toll-like receptor signaling pathway; organelle organization and biogenesis; MAPKKK cascade; peptidyl-threonine phosphorylation; microtubule cytoskeleton organization and biogenesis; DNA repair; MyD88-dependent toll-like receptor signaling pathway; G1/S-specific transcription in mitotic cell cycle; peptidyl-serine phosphorylation; response to cadmium ion; response to copper ion; regulation of ubiquitin-protein ligase activity during mitotic cell cycle; mitotic cell cycle G2/M transition DNA damage checkpoint; Ras protein signal transduction; insulin receptor signaling pathway; toll-like receptor signaling pathway; innate immune response; mitotic cell cycle; vascular endothelial growth factor receptor signaling pathway; positive regulation of DNA replication