Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDCA7 cdna clone

CDCA7 cDNA Clone

Gene Names
CDCA7; ICF3; JPO1
Synonyms
CDCA7; CDCA7 cDNA Clone; CDCA7 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgctcgccgcgtgccgcagaaagatctcagagtaaagaagaacttaaagaaattcagatatgtgaagttgatttccatggaaacctcgtcatcctctgatgacagttgtgacagctttgcttctgataattttgcaaacacgaggctgcagtcagttcgggaaggctgtaggacccgcagccagtgcaggcactctggacctctcagggtggcgatgaagtttccagcgcggagtaccaggggagcaaccaacaaaaaagcagagtcccgccagccctcagagaattctgtgactgattccaactccgattcagaagatgaaagtggaatgaattttttggagaaaagggctttaaatataaagcaaaacaaagcaatgcttgcaaaactcatgtctgaattagaaagcttccctggctcgttccgtggaagacatcccctcccaggctccgactcacaatcaaggagaccgcgaaggcgtacattcccgggtgttgcttccaggagaaaccctgaacggagagctcgtcctcttaccaggtcaaggtcccggatcctcgggtcccttgacgctctacccatggaggaggaggaggaagaggataagtacatgttggtgagaaagaggaagaccgtggatggctacatgaatgaagatgacctgcccagaagccgtcgctccagatcatccgtgacccttccgcatataattcgcccagtggaagaaattacagaggaggagttggagaacgtctgcagcaattctcgagagaagatatataaccgttcactgggctctacttgtcatcaatgccgtcagaagactattgataccaaaacaaactgcagaaacccagactgctggggcgttcgaggccagttctgtggcccctgccttcgaaaccgttatggtgaagaggtcagggatgctctgctggatccgaactggcattgcccgccttgtcgaggaatctgcaactgcagtttctgccggcagcgagatggacggtgtgcgactggggtccttgtgtatttagccaaatatcatggctttgggaatgtgcatgcctacttgaaaagcctgaaacaggaatttgaaatgcaagcataa
Sequence Length
1116
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,400 Da
NCBI Official Full Name
Homo sapiens cell division cycle associated 7, mRNA
NCBI Official Synonym Full Names
cell division cycle associated 7
NCBI Official Symbol
CDCA7
NCBI Official Synonym Symbols
ICF3; JPO1
NCBI Protein Information
cell division cycle-associated protein 7
UniProt Protein Name
Cell division cycle-associated protein 7
UniProt Gene Name
CDCA7
UniProt Synonym Gene Names
JPO1
UniProt Entry Name
CDCA7_HUMAN

NCBI Description

This gene was identified as a c-Myc responsive gene, and behaves as a direct c-Myc target gene. Overexpression of this gene is found to enhance the transformation of lymphoblastoid cells, and it complements a transformation-defective Myc Box II mutant, suggesting its involvement in c-Myc-mediated cell transformation. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

CDCA7: Participates in MYC-mediated cell transformation; induces anchorage-independent growth and clonogenicity in lymphoblastoid cells. Insufficient to induce tumorigenicity when overexpressed but contributes to MYC-mediated tumorigenesis. May play a role as transcriptional regulator. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 2q31

Cellular Component: cytoplasm; nucleoplasm; nucleus

Biological Process: regulation of cell proliferation

Disease: Immunodeficiency-centromeric Instability-facial Anomalies Syndrome 3

Research Articles on CDCA7

Similar Products

Product Notes

The CDCA7 cdca7 (Catalog #AAA1275911) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgctc gccgcgtgcc gcagaaagat ctcagagtaa agaagaactt aaagaaattc agatatgtga agttgatttc catggaaacc tcgtcatcct ctgatgacag ttgtgacagc tttgcttctg ataattttgc aaacacgagg ctgcagtcag ttcgggaagg ctgtaggacc cgcagccagt gcaggcactc tggacctctc agggtggcga tgaagtttcc agcgcggagt accaggggag caaccaacaa aaaagcagag tcccgccagc cctcagagaa ttctgtgact gattccaact ccgattcaga agatgaaagt ggaatgaatt ttttggagaa aagggcttta aatataaagc aaaacaaagc aatgcttgca aaactcatgt ctgaattaga aagcttccct ggctcgttcc gtggaagaca tcccctccca ggctccgact cacaatcaag gagaccgcga aggcgtacat tcccgggtgt tgcttccagg agaaaccctg aacggagagc tcgtcctctt accaggtcaa ggtcccggat cctcgggtcc cttgacgctc tacccatgga ggaggaggag gaagaggata agtacatgtt ggtgagaaag aggaagaccg tggatggcta catgaatgaa gatgacctgc ccagaagccg tcgctccaga tcatccgtga cccttccgca tataattcgc ccagtggaag aaattacaga ggaggagttg gagaacgtct gcagcaattc tcgagagaag atatataacc gttcactggg ctctacttgt catcaatgcc gtcagaagac tattgatacc aaaacaaact gcagaaaccc agactgctgg ggcgttcgag gccagttctg tggcccctgc cttcgaaacc gttatggtga agaggtcagg gatgctctgc tggatccgaa ctggcattgc ccgccttgtc gaggaatctg caactgcagt ttctgccggc agcgagatgg acggtgtgcg actggggtcc ttgtgtattt agccaaatat catggctttg ggaatgtgca tgcctacttg aaaagcctga aacaggaatt tgaaatgcaa gcataa. It is sometimes possible for the material contained within the vial of "CDCA7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.