Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC42EP4 cdna clone

CDC42EP4 cDNA Clone

Gene Names
CDC42EP4; CEP4; BORG4; KAIA1777
Synonyms
CDC42EP4; CDC42EP4 cDNA Clone; CDC42EP4 cdna clone
Ordering
For Research Use Only!
Sequence
atgctaatcctcaagcaactggtgtccagctcggtgcactccaagcgccgttcccgagcggacctcacggccgagatgatcagcgccccgctgggcgacttccgccacaccatgcacgttggccgggccggagacgcctttggggacacctccttcctcaatagcaaggctggcgagcccgacggcgagtccttggacgaacagccctcttcttcatcttccaaacgcagtctcctgtccaggaagttccggggcagcaagcggtcacagtcggtgaccaggggggagcgggagcagcgtgacatgctgggctccctgcgggactcggccctgtttgtcaagaatgccatgtccctgccccagctcaatgagaaggaggccgcggagaagggcaccagtaagctgcccaagagcctgtcatccagccccgtgaagaaggccaatgacggggagggcggcgatgaggaggcgggcacggaggaggcagtgccccgtcggaatggggccgcgggtccacattcccctgaccccctcctcgatgagcaggcctttggggatctgacagatctgcctgtcgtgcccaaggccacgtacgggctgaagcatgcggagtccatcatgtccttccacatcgacctggggccctccatgctgggtgacgtcctcagcatcatggacaaggaggagtgggaccccgaggagggggagggtggttaccatggcgatgagggcgccgctggcaccatcacccaggctcccccgtacgccgtggcggcccctcccctggcaaggcaggaaggcaaggctggcccagacttgccctccctcccctcccatgctctggaggatgaggggtgggcagcagcggcccccagccccggctcagcccgcagcatgggcagccacaccacacgggacagcagctccctctccagctgcacctcaggcatcctggaggagcgcagccctgccttccgggggccggacagggcccgggctgctgtctcaagacagccagacaaggagttctccttcatggatgaggaggaggaggatgaaatccgtgtgtga
Sequence Length
1071
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,214 Da
NCBI Official Full Name
Homo sapiens CDC42 effector protein (Rho GTPase binding) 4, mRNA
NCBI Official Synonym Full Names
CDC42 effector protein 4
NCBI Official Symbol
CDC42EP4
NCBI Official Synonym Symbols
CEP4; BORG4; KAIA1777
NCBI Protein Information
cdc42 effector protein 4
UniProt Protein Name
Cdc42 effector protein 4
Protein Family
UniProt Gene Name
CDC42EP4
UniProt Synonym Gene Names
BORG4; CEP4
UniProt Entry Name
BORG4_HUMAN

NCBI Description

The product of this gene is a member of the CDC42-binding protein family. Members of this family interact with Rho family GTPases and regulate the organization of the actin cytoskeleton. This protein has been shown to bind both CDC42 and TC10 GTPases in a GTP-dependent manner. When overexpressed in fibroblasts, this protein was able to induce pseudopodia formation, which suggested a role in inducing actin filament assembly and cell shape control. [provided by RefSeq, Jul 2008]

Uniprot Description

CDC42EP4: Probably involved in the organization of the actin cytoskeleton. May act downstream of CDC42 to induce actin filament assembly leading to cell shape changes. Induces pseudopodia formation, when overexpressed in fibroblasts. Belongs to the BORG/CEP family.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 17q24-q25

Cellular Component: actin cytoskeleton; cytoplasm; intercellular junction; microtubule cytoskeleton; plasma membrane

Molecular Function: GTP-Rho binding; GTPase activator activity; protein binding

Biological Process: positive regulation of actin filament polymerization; positive regulation of pseudopodium formation; regulation of cell shape; Rho protein signal transduction

Research Articles on CDC42EP4

Similar Products

Product Notes

The CDC42EP4 cdc42ep4 (Catalog #AAA1274216) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctaatcc tcaagcaact ggtgtccagc tcggtgcact ccaagcgccg ttcccgagcg gacctcacgg ccgagatgat cagcgccccg ctgggcgact tccgccacac catgcacgtt ggccgggccg gagacgcctt tggggacacc tccttcctca atagcaaggc tggcgagccc gacggcgagt ccttggacga acagccctct tcttcatctt ccaaacgcag tctcctgtcc aggaagttcc ggggcagcaa gcggtcacag tcggtgacca ggggggagcg ggagcagcgt gacatgctgg gctccctgcg ggactcggcc ctgtttgtca agaatgccat gtccctgccc cagctcaatg agaaggaggc cgcggagaag ggcaccagta agctgcccaa gagcctgtca tccagccccg tgaagaaggc caatgacggg gagggcggcg atgaggaggc gggcacggag gaggcagtgc cccgtcggaa tggggccgcg ggtccacatt cccctgaccc cctcctcgat gagcaggcct ttggggatct gacagatctg cctgtcgtgc ccaaggccac gtacgggctg aagcatgcgg agtccatcat gtccttccac atcgacctgg ggccctccat gctgggtgac gtcctcagca tcatggacaa ggaggagtgg gaccccgagg agggggaggg tggttaccat ggcgatgagg gcgccgctgg caccatcacc caggctcccc cgtacgccgt ggcggcccct cccctggcaa ggcaggaagg caaggctggc ccagacttgc cctccctccc ctcccatgct ctggaggatg aggggtgggc agcagcggcc cccagccccg gctcagcccg cagcatgggc agccacacca cacgggacag cagctccctc tccagctgca cctcaggcat cctggaggag cgcagccctg ccttccgggg gccggacagg gcccgggctg ctgtctcaag acagccagac aaggagttct ccttcatgga tgaggaggag gaggatgaaa tccgtgtgtg a. It is sometimes possible for the material contained within the vial of "CDC42EP4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.