Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC40 cdna clone

CDC40 cDNA Clone

Gene Names
CDC40; EHB3; PRP17; PRPF17
Synonyms
CDC40; CDC40 cDNA Clone; CDC40 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggctgcgattgcagctctggccgcttcctatggttcgggttcagggtccgaatcggactcggacagtgagagcagtcggtgtccgctgccagccgccgactccctcatgcacttgactaaatcgccttcatcaaagccgtctctagcagtggcagtggactcggctccggaggtggcagttaaggaagatttggagactggagttcaccttgaccctgccgtcaaagaagttcagtataatcctacctatgagaccatgtttgctcctgagtttggaccagaaaatccctttaggacacagcaaatggctgcccctagaaatatgctttctggatatgccgaaccagctcatatcaatgatttcatgtttgagcagcaaaggagaacttttgcaacatatggttatgcattagacccttcattagataatcatcaagtgtctgctaaatatattggttctgtagaagaagctgaaaaaaatcaaggtttaactgtatttgaaactggtcagaagaaaacagaaaagaggaaaaagtttaaagaaaatgatgcatccaatattgatggttttttgggaccatgggcaaaatatgtggatgaaaaagatgtagccaaaccttcagaagaagagcaaaaagaattggatgaaatcacagcaaagaggcagaaaaaaggaaaacaggaagaagagaaacctggggaggagaagacaatcttacatgttaaagaaatgtatgactatcaaggcaggtcctatcttcacatacctcaggatgttggtgttaatctacggtcaactatgccacctgagaagtgttatcttcccaaaaaacaaattcatgtgtggtctggacacacaaagggcgtcagtgcagtcagattgtttcctctctctggccatttattgctgtcttgttccatggactgtaaaattaagctatgggaggtttatggagaacggcgctgtctgagaacatttattggtcacagtaaggctgttagggatatctgcttcaatactgcaggaacacagttcctcagtgcagcctatgacaggtatcttaagctctgggacactgagacaggacagtgtatatcaagatttacaaaccgaaaagtaccttattgtgtcaaattcaatcctgatgaagataagcaaaatctctttgtggctgggatgtctgataagaagattgtgcaatgggacattcgaagtggagaaattgtgcaggaatatgatcggcatttgggagctgtcaacaccattgtttttgtggatgagaataggagatttgtgagcacatctgatgataaaagcctaagagtttgggaatgggatatccctgtggatttcaagtacatagcagaacccagtatgcactcaatgcctgcagtgactttgtctccaaatggaaaatggctagcatgccaatcaatggacaaccaaatcttaatttttggagcacagaacagatttagattaaataagaaaaaaatttttaagggccatatggtagcaggctatgcttgtcaggtggacttttcaccagacatgagttatgtgatttcaggagatggaaatggaaaattaaacatttgggactggaagaccacaaaactctacagtcgatttaaagctcatgataaagtgtgtataggtgcagtgtggcatcctcatgaaacttctaaggtcataacatgtggttgggatggtctcattaaattgtgggattaa
Sequence Length
1740
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,521 Da
NCBI Official Full Name
Homo sapiens cell division cycle 40 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
cell division cycle 40
NCBI Official Symbol
CDC40
NCBI Official Synonym Symbols
EHB3; PRP17; PRPF17
NCBI Protein Information
pre-mRNA-processing factor 17
UniProt Protein Name
Pre-mRNA-processing factor 17
UniProt Gene Name
CDC40
UniProt Synonym Gene Names
EHB3; PRP17; PRPF17; Ehb3; hPRP17
UniProt Entry Name
PRP17_HUMAN

NCBI Description

Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is found to be essential for the catalytic step II in pre-mRNA splicing process. It is found in the spliceosome, and contains seven WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp17 protein, which functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. It suggests that this protein may play a role in cell cycle progression. [provided by RefSeq, Jul 2008]

Uniprot Description

CDC40: Associates with the spliceosome late in the splicing pathway and may function in the second step of pre-mRNA splicing.

Protein type: Spliceosome; RNA processing; Motility/polarity/chemotaxis; RNA splicing

Chromosomal Location of Human Ortholog: 6q21

Cellular Component: nucleoplasm; spliceosome

Molecular Function: protein binding; second spliceosomal transesterification activity

Biological Process: generation of catalytic spliceosome for second transesterification step; mRNA 3'-end processing; mRNA export from nucleus; nuclear mRNA splicing, via spliceosome; RNA export from nucleus; RNA splicing; termination of RNA polymerase II transcription

Research Articles on CDC40

Similar Products

Product Notes

The CDC40 cdc40 (Catalog #AAA1274539) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggctg cgattgcagc tctggccgct tcctatggtt cgggttcagg gtccgaatcg gactcggaca gtgagagcag tcggtgtccg ctgccagccg ccgactccct catgcacttg actaaatcgc cttcatcaaa gccgtctcta gcagtggcag tggactcggc tccggaggtg gcagttaagg aagatttgga gactggagtt caccttgacc ctgccgtcaa agaagttcag tataatccta cctatgagac catgtttgct cctgagtttg gaccagaaaa tccctttagg acacagcaaa tggctgcccc tagaaatatg ctttctggat atgccgaacc agctcatatc aatgatttca tgtttgagca gcaaaggaga acttttgcaa catatggtta tgcattagac ccttcattag ataatcatca agtgtctgct aaatatattg gttctgtaga agaagctgaa aaaaatcaag gtttaactgt atttgaaact ggtcagaaga aaacagaaaa gaggaaaaag tttaaagaaa atgatgcatc caatattgat ggttttttgg gaccatgggc aaaatatgtg gatgaaaaag atgtagccaa accttcagaa gaagagcaaa aagaattgga tgaaatcaca gcaaagaggc agaaaaaagg aaaacaggaa gaagagaaac ctggggagga gaagacaatc ttacatgtta aagaaatgta tgactatcaa ggcaggtcct atcttcacat acctcaggat gttggtgtta atctacggtc aactatgcca cctgagaagt gttatcttcc caaaaaacaa attcatgtgt ggtctggaca cacaaagggc gtcagtgcag tcagattgtt tcctctctct ggccatttat tgctgtcttg ttccatggac tgtaaaatta agctatggga ggtttatgga gaacggcgct gtctgagaac atttattggt cacagtaagg ctgttaggga tatctgcttc aatactgcag gaacacagtt cctcagtgca gcctatgaca ggtatcttaa gctctgggac actgagacag gacagtgtat atcaagattt acaaaccgaa aagtacctta ttgtgtcaaa ttcaatcctg atgaagataa gcaaaatctc tttgtggctg ggatgtctga taagaagatt gtgcaatggg acattcgaag tggagaaatt gtgcaggaat atgatcggca tttgggagct gtcaacacca ttgtttttgt ggatgagaat aggagatttg tgagcacatc tgatgataaa agcctaagag tttgggaatg ggatatccct gtggatttca agtacatagc agaacccagt atgcactcaa tgcctgcagt gactttgtct ccaaatggaa aatggctagc atgccaatca atggacaacc aaatcttaat ttttggagca cagaacagat ttagattaaa taagaaaaaa atttttaagg gccatatggt agcaggctat gcttgtcagg tggacttttc accagacatg agttatgtga tttcaggaga tggaaatgga aaattaaaca tttgggactg gaagaccaca aaactctaca gtcgatttaa agctcatgat aaagtgtgta taggtgcagt gtggcatcct catgaaactt ctaaggtcat aacatgtggt tgggatggtc tcattaaatt gtgggattaa. It is sometimes possible for the material contained within the vial of "CDC40, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.