Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD93 cdna clone

CD93 cDNA Clone

Gene Names
CD93; C1QR1; C1qRP; CDw93; ECSM3; MXRA4; C1qR(P); dJ737E23.1
Synonyms
CD93; CD93 cDNA Clone; CD93 cdna clone
Ordering
For Research Use Only!
Sequence
atggccacctccatgggcctgctgctgctgctgctgctgctcctgacccagcccggggcggggacgggagctgacacggaggcggtggtctgcgtggggaccgcctgctacacggcccactcgggcaagctgagcgctgccgaggcccagaaccactgcaaccagaacgggggcaacctggccactgtgaagagcaaggaggaggcccagcacgtccagcgagtactggcccagctcctgaggcgggaggcagccctgacggcgaggatgagcaagttctggattgggctccagcgagagaagggcaagtgcctggaccctagtctgccgctgaagggcttcagctgggtgggcgggggggaggacacgccttactctaactggcacaaggagctccggaactcgtgcatctccaagcgctgtgtgtctctgctgctggacctgtcccagccgctccttcccagccgcctccccaagtggtctgagggcccctgtgggagcccaggctcccccggaagtaacattgagggcttcgtgtgcaagttcagcttcaaaggcatgtgccggcctctggccctggggggcccaggtcaggtgacctacaccacccccttccagaccaccagttcctccttggaggctgtgccctttgcctctgcggccaatgtagcctgtggggaaggtgacaaggacgagactcagagtcattatttcctgtgcaaggagaaggcccccgatgtgttcgactggggcagctcgggccccctctgtgtcagccccaagtatggctgcaacttcaacaatgggggctgccaccaggactgctttgaagggggggatggctccttcctctgcggctgccgaccaggattccggctgctggatgacctggtgacctgtgcctctcgaaacccttgcagctccagcccatgtcgtgggggggccacgtgcgtcctgggaccccatgggaaaaactacacgtgccgctgcccccaagggtaccagctggactcgagtcagctggactgtgtggacgtggatgaatgccaggactccccctgtgcccaggagtgtgtcaacacccctgggggcttccgctgcgaatgctgggttggctatgagccgggcggtcctggagagggggcctgtcaggatgtggatgagtgtgctctgggtcgctcgccttgcgcccagggctgcaccaacacagatggctcatttcactgctcctgtgaggagggctacgtcctggccggggaggacgggactcagtgccaggacgtggatgagtgtgtgggcccggggggccccctctgcgacagcttgtgcttcaacacacaagggtccttccactgtggctgcctgccaggctgggtgctggccccaaatggggtctcttgcaccatggggcctgtgtctctgggaccaccatctgggccccccgatgaggaggacaaaggagagaaagaagggagcaccgtgccccgtgctgcaacagccagtcccacaaggggccccgagggcacccccaaggctacacccaccacaagtagaccttcgctgtcatctgacgcccccatcacatctgccccactcaagatgctggcccccagtgggtccccaggcgtctggagggagcccagcatccatcacgccacagctgcctctggcccccaggagcctgcaggtggggactcctccgtggccacacaaaacaacgatggcactgacgggcaaaagctgcttttattctacatcctaggcaccgtggtggccatcctactcctgctggccctggctctggggctactggtctatcgcaagcggagagcgaagagggaggagaagaaggagaagaagccccagaatgcggcagacagttactcctgggttccagagcgagctgagagcagggccatggagaaccagtacagtccgacacctgggacagactgctga
Sequence Length
1959
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,560 Da
NCBI Official Full Name
Homo sapiens CD93 molecule, mRNA
NCBI Official Synonym Full Names
CD93 molecule
NCBI Official Symbol
CD93
NCBI Official Synonym Symbols
C1QR1; C1qRP; CDw93; ECSM3; MXRA4; C1qR(P); dJ737E23.1
NCBI Protein Information
complement component C1q receptor
UniProt Protein Name
Complement component C1q receptor
UniProt Gene Name
CD93
UniProt Synonym Gene Names
C1QR1; MXRA4; C1qR; C1qR(p); C1qRp
UniProt Entry Name
C1QR1_HUMAN

NCBI Description

The protein encoded by this gene is a cell-surface glycoprotein and type I membrane protein that was originally identified as a myeloid cell-specific marker. The encoded protein was once thought to be a receptor for C1q, but now is thought to instead be involved in intercellular adhesion and in the clearance of apoptotic cells. The intracellular cytoplasmic tail of this protein has been found to interact with moesin, a protein known to play a role in linking transmembrane proteins to the cytoskeleton and in the remodelling of the cytoskeleton. [provided by RefSeq, Jul 2008]

Uniprot Description

CD93: Receptor (or element of a larger receptor complex) for C1q, mannose-binding lectin (MBL2) and pulmonary surfactant protein A (SPA). May mediate the enhancement of phagocytosis in monocytes and macrophages upon interaction with soluble defense collagens. May play a role in intercellular adhesion.

Protein type: Cell adhesion; Membrane protein, integral

Chromosomal Location of Human Ortholog: 20p11.21

Cellular Component: extracellular matrix; integral to membrane; plasma membrane

Molecular Function: complement component C1q binding; protein binding

Biological Process: cell-cell adhesion; positive regulation of defense response to virus by host

Research Articles on CD93

Similar Products

Product Notes

The CD93 cd93 (Catalog #AAA1277860) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccacct ccatgggcct gctgctgctg ctgctgctgc tcctgaccca gcccggggcg gggacgggag ctgacacgga ggcggtggtc tgcgtgggga ccgcctgcta cacggcccac tcgggcaagc tgagcgctgc cgaggcccag aaccactgca accagaacgg gggcaacctg gccactgtga agagcaagga ggaggcccag cacgtccagc gagtactggc ccagctcctg aggcgggagg cagccctgac ggcgaggatg agcaagttct ggattgggct ccagcgagag aagggcaagt gcctggaccc tagtctgccg ctgaagggct tcagctgggt gggcgggggg gaggacacgc cttactctaa ctggcacaag gagctccgga actcgtgcat ctccaagcgc tgtgtgtctc tgctgctgga cctgtcccag ccgctccttc ccagccgcct ccccaagtgg tctgagggcc cctgtgggag cccaggctcc cccggaagta acattgaggg cttcgtgtgc aagttcagct tcaaaggcat gtgccggcct ctggccctgg ggggcccagg tcaggtgacc tacaccaccc ccttccagac caccagttcc tccttggagg ctgtgccctt tgcctctgcg gccaatgtag cctgtgggga aggtgacaag gacgagactc agagtcatta tttcctgtgc aaggagaagg cccccgatgt gttcgactgg ggcagctcgg gccccctctg tgtcagcccc aagtatggct gcaacttcaa caatgggggc tgccaccagg actgctttga agggggggat ggctccttcc tctgcggctg ccgaccagga ttccggctgc tggatgacct ggtgacctgt gcctctcgaa acccttgcag ctccagccca tgtcgtgggg gggccacgtg cgtcctggga ccccatggga aaaactacac gtgccgctgc ccccaagggt accagctgga ctcgagtcag ctggactgtg tggacgtgga tgaatgccag gactccccct gtgcccagga gtgtgtcaac acccctgggg gcttccgctg cgaatgctgg gttggctatg agccgggcgg tcctggagag ggggcctgtc aggatgtgga tgagtgtgct ctgggtcgct cgccttgcgc ccagggctgc accaacacag atggctcatt tcactgctcc tgtgaggagg gctacgtcct ggccggggag gacgggactc agtgccagga cgtggatgag tgtgtgggcc cggggggccc cctctgcgac agcttgtgct tcaacacaca agggtccttc cactgtggct gcctgccagg ctgggtgctg gccccaaatg gggtctcttg caccatgggg cctgtgtctc tgggaccacc atctgggccc cccgatgagg aggacaaagg agagaaagaa gggagcaccg tgccccgtgc tgcaacagcc agtcccacaa ggggccccga gggcaccccc aaggctacac ccaccacaag tagaccttcg ctgtcatctg acgcccccat cacatctgcc ccactcaaga tgctggcccc cagtgggtcc ccaggcgtct ggagggagcc cagcatccat cacgccacag ctgcctctgg cccccaggag cctgcaggtg gggactcctc cgtggccaca caaaacaacg atggcactga cgggcaaaag ctgcttttat tctacatcct aggcaccgtg gtggccatcc tactcctgct ggccctggct ctggggctac tggtctatcg caagcggaga gcgaagaggg aggagaagaa ggagaagaag ccccagaatg cggcagacag ttactcctgg gttccagagc gagctgagag cagggccatg gagaaccagt acagtccgac acctgggaca gactgctga. It is sometimes possible for the material contained within the vial of "CD93, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.