Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD300LB cdna clone

CD300LB cDNA Clone

Gene Names
CD300LB; CLM7; CLM-7; IREM3; TREM5; CD300b; IREM-3; TREM-5; CMRF35-A2
Synonyms
CD300LB; CD300LB cDNA Clone; CD300LB cdna clone
Ordering
For Research Use Only!
Sequence
atgtgcagaaggtgcaagccagagctcgggcagaacttccagagtgcatctgggatctgcatttgccactggttgcagatcaggcggacgaggagccgggaaggcagagccatgtggctgccccctgctctgctccttctcagcctctcaggctgtttctccatccaaggcccagagtctgtgagagccccagagcaggggtccctgacggttcaatgccactataagcaaggatgggagacctacattaagtggtggtgccgaggggtgcgctgggatacatgcaagatcctcattgaaaccagagggtcggagcaaggagagaagagtgaccgtgtgtccatcaaggacaatcagaaagaccgcacgttcactgtgaccatggaggggctcaggcgagatgacgcagatgtttactggtgtgggattgaaagaagaggacctgaccttgggactcaagtgaaagtgatcgttgacccagagggagcggcttccacaacagcaagctcacctaccaacagcaatatggcagtgttcatcggctcccacaagaggaaccactacatgctcctggtatttgtgaaggtgcccatcttgctcatcttggtcactgccatcctctggttgaaggggtctcagagggtccctgaggagccaggggaacagcctatctacatgaacttctccgaacctctgactaaagacatggccacttag
Sequence Length
717
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,689 Da
NCBI Official Full Name
Homo sapiens CD300 molecule-like family member b, mRNA
NCBI Official Synonym Full Names
CD300 molecule like family member b
NCBI Official Symbol
CD300LB
NCBI Official Synonym Symbols
CLM7; CLM-7; IREM3; TREM5; CD300b; IREM-3; TREM-5; CMRF35-A2
NCBI Protein Information
CMRF35-like molecule 7
UniProt Protein Name
CMRF35-like molecule 7
Protein Family
UniProt Gene Name
CD300LB
UniProt Synonym Gene Names
CD300B; CLM7; CMRF35A2; IREM3; LMIR5; TREM5; CLM-7; IREM-3; TREM-5
UniProt Entry Name
CLM7_HUMAN

NCBI Description

CD300LB is a nonclassical activating receptor of the immunoglobulin (Ig) superfamily expressed on myeloid cells (Martinez-Barriocanal and Sayos, 2006 [PubMed 16920917]).[supplied by OMIM, Mar 2008]

Uniprot Description

CD300LB: Acts as an activating immune receptor through its interaction with ITAM-bearing adapter TYROBP, and also independently by recruitment of GRB2. Belongs to the CD300 family.

Protein type: Receptor, misc.; Membrane protein, integral

Chromosomal Location of Human Ortholog: 17q25.1

Cellular Component: plasma membrane

Biological Process: innate immune response; regulation of immune response

Research Articles on CD300LB

Similar Products

Product Notes

The CD300LB cd300lb (Catalog #AAA1269085) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgcagaa ggtgcaagcc agagctcggg cagaacttcc agagtgcatc tgggatctgc atttgccact ggttgcagat caggcggacg aggagccggg aaggcagagc catgtggctg ccccctgctc tgctccttct cagcctctca ggctgtttct ccatccaagg cccagagtct gtgagagccc cagagcaggg gtccctgacg gttcaatgcc actataagca aggatgggag acctacatta agtggtggtg ccgaggggtg cgctgggata catgcaagat cctcattgaa accagagggt cggagcaagg agagaagagt gaccgtgtgt ccatcaagga caatcagaaa gaccgcacgt tcactgtgac catggagggg ctcaggcgag atgacgcaga tgtttactgg tgtgggattg aaagaagagg acctgacctt gggactcaag tgaaagtgat cgttgaccca gagggagcgg cttccacaac agcaagctca cctaccaaca gcaatatggc agtgttcatc ggctcccaca agaggaacca ctacatgctc ctggtatttg tgaaggtgcc catcttgctc atcttggtca ctgccatcct ctggttgaag gggtctcaga gggtccctga ggagccaggg gaacagccta tctacatgaa cttctccgaa cctctgacta aagacatggc cacttag. It is sometimes possible for the material contained within the vial of "CD300LB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.