Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD1C cdna clone

CD1C cDNA Clone

Gene Names
CD1C; R7; CD1; CD1A; BDCA1
Synonyms
CD1C; CD1C cDNA Clone; CD1C cdna clone
Ordering
For Research Use Only!
Sequence
atgctgtttctgcagtttctgctgctagctcttcttctcccaggtggtgacaatgcagacgcatcccaggaacacgtctccttccatgtcatccagatcttctcatttgtcaaccaatcctgggcacgaggtcagggctcaggatggctggacgagttgcagactcatggctgggacagtgaatcaggcacaataattttcctgcataactggtccaagggcaacttcagcaatgaagagttgtcagacctagagttgttatttcgtttctacctctttggattaactcgggagattcaagaccatgcaagtcaagattactcgaaatatccctttgaagtacaggtgaaagcgggctgtgagctgcattctggaaagagcccagaaggcttctttcaggtagctttcaacggattagatttactgagtttccagaatacaacatgggtgccatctccaggctgtggaagtttggcccaaagtgtctgtcatctactcaatcatcagtatgaaggcgtcacagaaacagtgtataatctcataagaagcacttgcccccgatttctcttgggtctcctggatgcagggaagatgtatgtacacaggcaagtgaggccagaagcctggctgtccagtcgccccagccttgggtctggccagctgttgctggtttgtcatgcctccggcttctacccaaagcctgtttgggtgacatggatgcggaatgaacaggagcaactgggcactaaacatggtgatattcttcctaatgctgatgggacatggtatcttcaggtgatcctggaggtggcatctgaggagcctgctggcctgtcttgtcgagtgagacacagcagtctaggaggccaggacatcatcctctactggggacaccacttttccatgaattggattgccttggtagtgatagtgcccttggtgattctaatagtccttgtgttatggtttaagaagcactgctcatatcaggacatcctgtga
Sequence Length
1002
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
911
Molecular Weight
37,654 Da
NCBI Official Full Name
Homo sapiens CD1c molecule, mRNA
NCBI Official Synonym Full Names
CD1c molecule
NCBI Official Symbol
CD1C
NCBI Official Synonym Symbols
R7; CD1; CD1A; BDCA1
NCBI Protein Information
T-cell surface glycoprotein CD1c
UniProt Protein Name
T-cell surface glycoprotein CD1c
UniProt Gene Name
CD1C
UniProt Entry Name
CD1C_HUMAN

NCBI Description

This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene is broadly distributed throughout the endocytic system via a tyrosine-based motif in the cytoplasmic tail. Alternatively spliced transcript variants of this gene have been observed, but their full-length nature is not known. [provided by RefSeq, Jul 2008]

Uniprot Description

CD1C: Antigen-presenting protein that binds self and non-self lipid and glycolipid antigens and presents them to T-cell receptors on natural killer T-cells.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q23.1

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: beta-2-microglobulin binding; endogenous lipid antigen binding; exogenous lipid antigen binding; glycolipid binding

Biological Process: antigen processing and presentation, exogenous lipid antigen via MHC class Ib; regulation of immune response; T cell activation during immune response

Research Articles on CD1C

Similar Products

Product Notes

The CD1C cd1c (Catalog #AAA1265845) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgtttc tgcagtttct gctgctagct cttcttctcc caggtggtga caatgcagac gcatcccagg aacacgtctc cttccatgtc atccagatct tctcatttgt caaccaatcc tgggcacgag gtcagggctc aggatggctg gacgagttgc agactcatgg ctgggacagt gaatcaggca caataatttt cctgcataac tggtccaagg gcaacttcag caatgaagag ttgtcagacc tagagttgtt atttcgtttc tacctctttg gattaactcg ggagattcaa gaccatgcaa gtcaagatta ctcgaaatat ccctttgaag tacaggtgaa agcgggctgt gagctgcatt ctggaaagag cccagaaggc ttctttcagg tagctttcaa cggattagat ttactgagtt tccagaatac aacatgggtg ccatctccag gctgtggaag tttggcccaa agtgtctgtc atctactcaa tcatcagtat gaaggcgtca cagaaacagt gtataatctc ataagaagca cttgcccccg atttctcttg ggtctcctgg atgcagggaa gatgtatgta cacaggcaag tgaggccaga agcctggctg tccagtcgcc ccagccttgg gtctggccag ctgttgctgg tttgtcatgc ctccggcttc tacccaaagc ctgtttgggt gacatggatg cggaatgaac aggagcaact gggcactaaa catggtgata ttcttcctaa tgctgatggg acatggtatc ttcaggtgat cctggaggtg gcatctgagg agcctgctgg cctgtcttgt cgagtgagac acagcagtct aggaggccag gacatcatcc tctactgggg acaccacttt tccatgaatt ggattgcctt ggtagtgata gtgcccttgg tgattctaat agtccttgtg ttatggttta agaagcactg ctcatatcag gacatcctgt ga. It is sometimes possible for the material contained within the vial of "CD1C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.