Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD177 cdna clone

CD177 cDNA Clone

Gene Names
CD177; NB1; PRV1; HNA2A; PRV-1; HNA-2a; NB1 GP
Synonyms
CD177; CD177 cDNA Clone; CD177 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcccggtattactgctggccctcctggggttcatcctcccactgccaggagtgcaggcgctgctctgccagtttgggacagttcagcatgtgtggaaggtgtccgacctgccccggcaatggacccctaagaacaccagctgcgacagcggcttggggtgccaggacacgttgatgctcattgagagcggaccccaagtgagcctggtgctctccaagggctgcacggaggccaaggaccaggagccccgcgtcactgagcaccggatgggccccggcctctccctgatctcctacaccttcgtgtgccgccaggaggacttctgcaacaacctcgttaactccctcccgctttgggccccacagcccccagcagacccaggatccttgaggtgcccagtctgcttgtctatggaaggctgtctggaggggacaacagaagagatctgccccaaggggaccacacactgttatgatggcctcctcaggctcaggggaggaggcatcttctccaatctgagagtccagggatgcatgccccagccaggttgcaacctgctcaatgggacacaggaaattgggcccgtgggtatgactgagaactgcaataggaaagattttctgacctgtcatcgggggaccaccattatgacacacggaaacttggctcaagaacccactgattggaccacatcgaataccgagatgtgcgaggtggggcaggtgtgtcaggagacgctgctgctcctagatgtaggactcacatcaaccctggtggggacaaaaggctgcagcactgttggggctcaaaattcccagaagaccaccatccactcagcccctcctggggtgcttgtggcctcctatacccacttctgctcctcggacctgtgcaatagtgccagcagcagcagcgttctgctgaactccctccctcctcaagctgcccctgtcccaggagaccggcagtgtcctacctgtgtgcagccccttggaacctgttcaagtggctccccccgaatgacctgccccaggggcaccactcattgttatgatgggtacattcatctctcaggaggtgggctgtccaccaaaatgagcattcagggctgcgtggcccaaccttccagcttcttgttgaaccacaccagacaaatcgggatcttctctgcgcgtgagaagcgtgatgtgcagcctcctgcctctcagcatgagggaggtggggctgagggcctggagtctctcacttggggggtggggctggcactggccccagcgctgtggtggggagtggtttgcccttcctgctaa
Sequence Length
1314
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,683 Da
NCBI Official Full Name
Homo sapiens CD177 molecule, mRNA
NCBI Official Synonym Full Names
CD177 molecule
NCBI Official Symbol
CD177
NCBI Official Synonym Symbols
NB1; PRV1; HNA2A; PRV-1; HNA-2a; NB1 GP
NCBI Protein Information
CD177 antigen
UniProt Protein Name
CD177 antigen
Protein Family
UniProt Gene Name
CD177
UniProt Synonym Gene Names
NB1; PRV1; HNA-2a; NB1 GP; PRV-1
UniProt Entry Name
CD177_HUMAN

NCBI Description

This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]

Uniprot Description

CD177: Induced by CSF3 in resting granulocytes. Induced in patients with polycythemia vera (PV) and with essential thrombocythemia (ET). 3 isoforms of the human protein are produced by alternative splicing

Protein type: Membrane protein, GPI anchor

Chromosomal Location of Human Ortholog: 19q13.2

Cellular Component: plasma membrane

Molecular Function: protein binding

Biological Process: blood coagulation; leukocyte migration

Research Articles on CD177

Similar Products

Product Notes

The CD177 cd177 (Catalog #AAA1276402) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcccgg tattactgct ggccctcctg gggttcatcc tcccactgcc aggagtgcag gcgctgctct gccagtttgg gacagttcag catgtgtgga aggtgtccga cctgccccgg caatggaccc ctaagaacac cagctgcgac agcggcttgg ggtgccagga cacgttgatg ctcattgaga gcggacccca agtgagcctg gtgctctcca agggctgcac ggaggccaag gaccaggagc cccgcgtcac tgagcaccgg atgggccccg gcctctccct gatctcctac accttcgtgt gccgccagga ggacttctgc aacaacctcg ttaactccct cccgctttgg gccccacagc ccccagcaga cccaggatcc ttgaggtgcc cagtctgctt gtctatggaa ggctgtctgg aggggacaac agaagagatc tgccccaagg ggaccacaca ctgttatgat ggcctcctca ggctcagggg aggaggcatc ttctccaatc tgagagtcca gggatgcatg ccccagccag gttgcaacct gctcaatggg acacaggaaa ttgggcccgt gggtatgact gagaactgca ataggaaaga ttttctgacc tgtcatcggg ggaccaccat tatgacacac ggaaacttgg ctcaagaacc cactgattgg accacatcga ataccgagat gtgcgaggtg gggcaggtgt gtcaggagac gctgctgctc ctagatgtag gactcacatc aaccctggtg gggacaaaag gctgcagcac tgttggggct caaaattccc agaagaccac catccactca gcccctcctg gggtgcttgt ggcctcctat acccacttct gctcctcgga cctgtgcaat agtgccagca gcagcagcgt tctgctgaac tccctccctc ctcaagctgc ccctgtccca ggagaccggc agtgtcctac ctgtgtgcag ccccttggaa cctgttcaag tggctccccc cgaatgacct gccccagggg caccactcat tgttatgatg ggtacattca tctctcagga ggtgggctgt ccaccaaaat gagcattcag ggctgcgtgg cccaaccttc cagcttcttg ttgaaccaca ccagacaaat cgggatcttc tctgcgcgtg agaagcgtga tgtgcagcct cctgcctctc agcatgaggg aggtggggct gagggcctgg agtctctcac ttggggggtg gggctggcac tggccccagc gctgtggtgg ggagtggttt gcccttcctg ctaa. It is sometimes possible for the material contained within the vial of "CD177, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.