CCNK cdna clone
CCNK cDNA Clone
Gene Names
CCNK; CPR4
Synonyms
CCNK; CCNK cDNA Clone; CCNK cdna clone
Sequence
atgaaggagaataaagaaaattcaagcccttcagtaacttcagcaaacctggaccacacaaagccatgttggtactgggataagaaagacttggctcatacaccctcacaacttgaaggacttgatccagccaccgaggcccggtaccgccgagagggcgctcggttcatctttgatgtgggcacacgtttggggctacactatgataccctggcaactggaataatttattttcatcgcttctatatgtttcattccttcaagcaattcccaagatatgtgacaggagcctgttgcctctttctggctgggaaagtagaagaaacaccaaaaaaatgtaaagatatcatcaaaacagctcgtagtttattaaatgatgtacaatttggccagtttggagatgacccaaaggaggaagtaatggttctggagagaatcttactgcagaccatcaagtttgatttacaggtagaacatccataccagttcctactaaaatatgcaaagcaactcaaaggtgataaaaacaaaattcaaaagttggttcaaatggcatggacatttgtaaatgacagtctctgcaccaccttgtcactgcagtgggaaccagagatcatagcagtagcagtgatgtatctcgcaggacgtttgtgcaaatttgaaatacaagaatggacctccaaacccatgtataggagatggtgggagcagtttgttcaagatgtcccggtcgacgttttggaagacatctgccaccaaatcctggatctttactcacaaggaaaacaacagatgcctcatcacaccccccatcagctgcaacagcccccatctcttcagcctacaccacaagtgccgcaagtacagcagtcacagccgtctcaaagctccgaaccatcccagccccagcagaaggaccccctcatcctcctccagggttgggcctgccgccagccagctacccacctcctgccgtcccccctggaggacagcctcctgtgcccccgcccattcccccacccggcatgcctccagttggggggctggggcgggcagcctggatga
Sequence Length
1065
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
66,137 Da
NCBI Official Full Name
Homo sapiens cyclin K, mRNA
NCBI Official Synonym Full Names
cyclin K
NCBI Official Symbol
CCNK
NCBI Official Synonym Symbols
CPR4
NCBI Protein Information
cyclin-K
UniProt Protein Name
Cyclin-K
Protein Family
UniProt Gene Name
CCNK
UniProt Synonym Gene Names
CPR4
UniProt Entry Name
CCNK_HUMAN
NCBI Description
The protein encoded by this gene is a member of the transcription cyclin family. These cyclins may regulate transcription through their association with and activation of cyclin-dependent kinases (CDK) that phosphorylate the C-terminal domain (CTD) of the large subunit of RNA polymerase II. This gene product may play a dual role in regulating CDK and RNA polymerase II activities. [provided by RefSeq, Jul 2008]
Uniprot Description
Regulatory subunit of cyclin-dependent kinases that mediates activation of target kinases. Plays a role in transcriptional regulation via its role in regulating the phosphorylation of the C-terminal domain (CTD) of the large subunit of RNA polymerase II (POLR2A).
Research Articles on CCNK
Similar Products
Product Notes
The CCNK ccnk (Catalog #AAA1276802) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggaga ataaagaaaa ttcaagccct tcagtaactt cagcaaacct ggaccacaca aagccatgtt ggtactggga taagaaagac ttggctcata caccctcaca acttgaagga cttgatccag ccaccgaggc ccggtaccgc cgagagggcg ctcggttcat ctttgatgtg ggcacacgtt tggggctaca ctatgatacc ctggcaactg gaataattta ttttcatcgc ttctatatgt ttcattcctt caagcaattc ccaagatatg tgacaggagc ctgttgcctc tttctggctg ggaaagtaga agaaacacca aaaaaatgta aagatatcat caaaacagct cgtagtttat taaatgatgt acaatttggc cagtttggag atgacccaaa ggaggaagta atggttctgg agagaatctt actgcagacc atcaagtttg atttacaggt agaacatcca taccagttcc tactaaaata tgcaaagcaa ctcaaaggtg ataaaaacaa aattcaaaag ttggttcaaa tggcatggac atttgtaaat gacagtctct gcaccacctt gtcactgcag tgggaaccag agatcatagc agtagcagtg atgtatctcg caggacgttt gtgcaaattt gaaatacaag aatggacctc caaacccatg tataggagat ggtgggagca gtttgttcaa gatgtcccgg tcgacgtttt ggaagacatc tgccaccaaa tcctggatct ttactcacaa ggaaaacaac agatgcctca tcacaccccc catcagctgc aacagccccc atctcttcag cctacaccac aagtgccgca agtacagcag tcacagccgt ctcaaagctc cgaaccatcc cagccccagc agaaggaccc cctcatcctc ctccagggtt gggcctgccg ccagccagct acccacctcc tgccgtcccc cctggaggac agcctcctgt gcccccgccc attcccccac ccggcatgcc tccagttggg gggctggggc gggcagcctg gatga. It is sometimes possible for the material contained within the vial of "CCNK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
