Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL20 cdna clone

CCL20 cDNA Clone

Gene Names
CCL20; CKb4; LARC; ST38; MIP3A; Exodus; MIP-3a; SCYA20; MIP-3-alpha
Synonyms
CCL20; CCL20 cDNA Clone; CCL20 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgctgtaccaagagtttgctcctggctgctttgatgtcagtgctgctactccacctctgcggcgaatcagaagcaagcaactttgactgctgtcttggatacacagaccgtattcttcatcctaaatttattgtgggcttcacacggcagctggccaatgaaggctgtgacatcaatgctatcatctttcacacaaagaaaaagttgtctgtgtgcgcaaatccaaaacagacttgggtgaaatatattgtgcgtctcctcagtaaaaaagtcaagaacatgtaa
Sequence Length
288
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,691 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 20, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 20
NCBI Official Symbol
CCL20
NCBI Official Synonym Symbols
CKb4; LARC; ST38; MIP3A; Exodus; MIP-3a; SCYA20; MIP-3-alpha
NCBI Protein Information
C-C motif chemokine 20
UniProt Protein Name
C-C motif chemokine 20
Protein Family
UniProt Gene Name
CCL20
UniProt Synonym Gene Names
LARC; MIP3A; SCYA20; MIP-3-alpha
UniProt Entry Name
CCL20_HUMAN

NCBI Description

This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene displays chemotactic activity for lymphocytes and can repress proliferation of myeloid progenitors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]

Uniprot Description

CCL20: Chemotactic factor that attracts lymphocytes and, slightly, neutrophils, but not monocytes. Inhibits proliferation of myeloid progenitors in colony formation assays. May be involved in formation and function of the mucosal lymphoid tissues by attracting lymphocytes and dendritic cells towards epithelial cells. C-terminal processed forms have been shown to be equally chemotactically active for leukocytes. Possesses antibacterial activity E.coli ATCC 25922 and S.aureus ATCC 29213. Belongs to the intercrine beta (chemokine CC) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted; Motility/polarity/chemotaxis; Chemokine

Chromosomal Location of Human Ortholog: 2q36.3

Cellular Component: extracellular region

Molecular Function: CCR chemokine receptor binding; CCR6 chemokine receptor binding; protein binding

Biological Process: cell-cell signaling; chemotaxis; G-protein coupled receptor protein signaling pathway; immune response; lymphocyte chemotaxis; monocyte chemotaxis; neutrophil chemotaxis; positive regulation of GTPase activity; signal transduction

Research Articles on CCL20

Similar Products

Product Notes

The CCL20 ccl20 (Catalog #AAA1268615) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgctgta ccaagagttt gctcctggct gctttgatgt cagtgctgct actccacctc tgcggcgaat cagaagcaag caactttgac tgctgtcttg gatacacaga ccgtattctt catcctaaat ttattgtggg cttcacacgg cagctggcca atgaaggctg tgacatcaat gctatcatct ttcacacaaa gaaaaagttg tctgtgtgcg caaatccaaa acagacttgg gtgaaatata ttgtgcgtct cctcagtaaa aaagtcaaga acatgtaa. It is sometimes possible for the material contained within the vial of "CCL20, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.