Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCDC85B cdna clone

CCDC85B cDNA Clone

Gene Names
CCDC85B; DIPA
Synonyms
CCDC85B; CCDC85B cDNA Clone; CCDC85B cdna clone
Ordering
For Research Use Only!
Sequence
atggaggccgaggcaggcggcctggaggagctgacggacgaggagatggcggcgctaggcaaggaagagctagtgcggcgcctgcggcgggaggaggcggcgcgcctggcggcactggtgcagcgcggccgcctcatgcaggaggtgaatcggcagctgcagggccacctgggcgagatccgcgagctcaagcagctcaaccggcgtctgcaggcagagaaccgtgagctgcgcgacctctgctgcttcctggactcggagcgccagcgcgggcggcgcgccgcacgccagtggcagctcttcgggacccaagcatcccgggccgtgcgcgaggacctgggcggctgttggcagaagctggccgagctggagggccgccaggaggagctgctgcgggagaacctagcgcttaaggagctctgcctggcgctgggcgaagaatggggcccccgcggcggccccagcggcgccgggggatcaggagccgggccagcacccgagcttgccttgcccccgtgcgggccccgcgacctaggcgatggaagctccagcactggcagcgtgggcagtccggatcagttgcccctggcctgttcccccgatgattga
Sequence Length
609
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,091 Da
NCBI Official Full Name
Homo sapiens coiled-coil domain containing 85B, mRNA
NCBI Official Synonym Full Names
coiled-coil domain containing 85B
NCBI Official Symbol
CCDC85B
NCBI Official Synonym Symbols
DIPA
NCBI Protein Information
coiled-coil domain-containing protein 85B
UniProt Protein Name
Coiled-coil domain-containing protein 85B
UniProt Gene Name
CCDC85B
UniProt Synonym Gene Names
DIPA; Delta-interacting protein A
UniProt Entry Name
CC85B_HUMAN

NCBI Description

Hepatitis delta virus (HDV) is a pathogenic human virus whose RNA genome and replication cycle resemble those of plant viroids. Delta-interacting protein A (DIPA), a cellular gene product, has been found to have homology to hepatitis delta virus antigen (HDAg). DIPA interacts with the viral antigen, HDAg, and can affect HDV replication in vitro. [provided by RefSeq, Jul 2008]

Uniprot Description

CCDC85B: Functions as a transcriptional repressor. May inhibit the activity of CTNNB1 in a TP53-dependent manner and thus regulate cell growth. May function in adipocyte differentiation, negatively regulating mitotic clonal expansion. Belongs to the CCDC85 family.

Protein type: Transcription regulation

Chromosomal Location of Human Ortholog: 11q12.1

Cellular Component: centrosome; nucleus

Molecular Function: protein binding

Biological Process: negative regulation of cell growth; negative regulation of fat cell differentiation; negative regulation of transcription, DNA-dependent

Research Articles on CCDC85B

Similar Products

Product Notes

The CCDC85B ccdc85b (Catalog #AAA1267206) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggccg aggcaggcgg cctggaggag ctgacggacg aggagatggc ggcgctaggc aaggaagagc tagtgcggcg cctgcggcgg gaggaggcgg cgcgcctggc ggcactggtg cagcgcggcc gcctcatgca ggaggtgaat cggcagctgc agggccacct gggcgagatc cgcgagctca agcagctcaa ccggcgtctg caggcagaga accgtgagct gcgcgacctc tgctgcttcc tggactcgga gcgccagcgc gggcggcgcg ccgcacgcca gtggcagctc ttcgggaccc aagcatcccg ggccgtgcgc gaggacctgg gcggctgttg gcagaagctg gccgagctgg agggccgcca ggaggagctg ctgcgggaga acctagcgct taaggagctc tgcctggcgc tgggcgaaga atggggcccc cgcggcggcc ccagcggcgc cgggggatca ggagccgggc cagcacccga gcttgccttg cccccgtgcg ggccccgcga cctaggcgat ggaagctcca gcactggcag cgtgggcagt ccggatcagt tgcccctggc ctgttccccc gatgattga. It is sometimes possible for the material contained within the vial of "CCDC85B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.