Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CBLB cdna clone

CBLB cDNA Clone

Gene Names
CBLB; Cbl-b; RNF56; Nbla00127
Synonyms
CBLB; CBLB cDNA Clone; CBLB cdna clone
Ordering
For Research Use Only!
Sequence
atggcaaactcaatgaatggcagaaaccctggtggtcgaggaggaaatccccgaaaaggtcgaattttgggtattattgatgctattcaggatgcagttggaccccctaagcaagctgccgcagatcgcaggaccgtggagaagacttggaagctcatggacaaagtggtaagactgtgccaaaatcccaaacttcagttgaaaaatagcccaccatatatacttgatattttgcctgatacatatcagcatttacgacttatattgagtaaatatgatgacaaccagaaacttgcccaactcagtgagaatgagtactttaaaatctacattgatagccttatgaaaaagtcaaaacgggcaataagactctttaaagaaggcaaggagagaatgtatgaagaacagtcacaggacagacgaaatctcacaaaactgtcccttatcttcagtcacatgctggcagaaatcaaagcaatctttcccaatggtcaattccagggagataactttcgtatcacaaaagcagatgctgctgaattctggagaaagttttttggagacaaaactatcgtaccatggaaagtattcagacagtgccttcatgaggtccaccagattagctctggcctggaagcaatggctctaaaatcaacaattgatttaacttgcaatgattacatttcagtttttgaatttgatatttttaccaggctgtttcagccttggggctctattttgcggaattggaatttcttagctgtgacacatccaggttacatggcatttctcacatatgatgaagttaaagcacgactacagaaatatagcaccaaacccggaagctatattttccggttaagttgcactcgattgggacagtgggccattggctatgtgactggggatgggaatatcttacagaccatacctcataacaagcccttatttcaagccctgattgatggcagcagggaaggattttatctttatcctgatgggaggagttataatcctgatttaactggattatgtgaacctacacctcatgaccatataaaagttacacaggaacaatatgaattatattgtgaaatgggctccacttttcagctctgtaagatttgtgcagagaatgacaaagatgtcaagattgagccttgtgggcatttgatgtgcacctcttgccttacggcatggcaggagtcggatggtcagggctgccctttctgtcgttgtgaaataaaaggaactgagcccataatcgtggatccctttgatccaagagatgaaggctccaggtgttgcagcatcattgacccctttggcatgccgatgctcgacttggacgacgatgatgatcgtgaggagtccttgatgatgaatcggttggcaaacgtccgaaagtgcactgacaggcagaactcaccagtcacatcaccaggatcctctccccttgcccagagaagaaagccacagcctgacccactccagatcccacatctaagcctgccacccgtgcctcctcgcctggatctaattcagaaaggcatagttagatctccctgtggcagcccaacgggttcaccaaagtcttctccttgcatggtgagaaaacaagataaaccactcccagcaccacctcctcccttaagagatcctcctccaccgccacctgaaagacctccaccaatcccaccagacaatagactgagtagacacatccatcatgtggaaagcgtgccttccaaagacccgccaatgcctcttgaagcatggtgccctcgggatgtgtttgggactaatcagcttgtgggatgtcgactcctaggggagggctctccaaaacctggaatcacagcgagttcaaatgtcaatggaaggcacagtagagtgggctctgacccagtgcttatgcggaaacacagacgccatgatttgcctttagaaggagctaaggtcttttccaatggtcaccttggaagtgaagaatatgatgttcctccccggctttctcctcctcctccagttaccaccctcctccctagcataaagtgtactggtccgttagcaaattctctttcagagaaaacaagagacccagtagaggaagatgatgatgaatacaagattccttcatcccaccctgtttccctgaattcacaaccatctcattgtcataatgtaaaacctcctgttcggtcttgtgataatggtcactgtatgctgaatggaacacatggtccatcttcagagaagaaatcaaacatccctgacttaagcatatatttaaagggagatgtttttgattcagcctctgatcccgtgccattaccacctgccaggcctccaactcgggacaatccaaagcatggttcttcactcaacaggacgccctctgattatgatcttctcatccctccattaggtgaagatgcttttgatgccctccctccatctctcccacctcccccacctcctgcaaggcatagtctcattgaacattcaaaacctcctggctccagtagccggccatcctcaggacaggatctttttcttcttccttcagatccctttgttgatctagcaagtggccaagttcctttgcctcccgctagaaggttaccaggtgaaaatgtcaaaactaacagaacatcacaggactatgatcagcttccttcatgttcagatggttcacaggcaccagccagaccccctaaaccacgaccgcgcaggactgcaccagaaattcaccacagaaaaccccatgggcctgaggcggcattggaaaatgtcgatgcaaaaattgcaaaactcatgggagagggttatgcctttgaagaggtgaagagagccttagagatagcccagaataatgtcgaagttgcccggagcatcctccgagaatttgccttccctcctccagtatccccacgtctaaatctatag
Sequence Length
2949
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
868
Molecular Weight
86,582 Da
NCBI Official Full Name
Homo sapiens Cas-Br-M (murine) ecotropic retroviral transforming sequence b, mRNA
NCBI Official Synonym Full Names
Cbl proto-oncogene B
NCBI Official Symbol
CBLB
NCBI Official Synonym Symbols
Cbl-b; RNF56; Nbla00127
NCBI Protein Information
E3 ubiquitin-protein ligase CBL-B
UniProt Protein Name
E3 ubiquitin-protein ligase CBL-B
UniProt Gene Name
CBLB
UniProt Synonym Gene Names
RNF56
UniProt Entry Name
CBLB_HUMAN

Uniprot Description

Cbl-b: E3 ubiquitin-protein ligase which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes, and transfers it to substrates, generally promoting their degradation by the proteasome. Negatively regulates TCR (T-cell receptor), BCR (B- cell receptor) and FCER1 (high affinity immunoglobulin epsilon receptor) signal transduction pathways. In naive T-cells, inhibits VAV1 activation upon TCR engagement and imposes a requirement for CD28 costimulation for proliferation and IL-2 production. Also acts by promoting PIK3R1/p85 ubiquitination, which impairs its recruitment to the TCR and subsequent activation. In activated T- cells, inhibits PLCG1 activation and calcium mobilization upon restimulation and promotes anergy. In B-cells, acts by ubiquitinating SYK and promoting its proteasomal degradation. May also be involved in EGFR ubiquitination and internalization. Interacts with SH3 domain-containing proteins LCK, CRK and SORBS1. Interacts with LCP2 and ZAP70. May interact with CBL. Interacts with SH3 domain-containing proteins VAV1, FYN, FGR, PLCG1, GRB2, CRKL, PIK3R1 and SH3KBP1/CIN85. Identified in heterotrimeric complexes with SH3KBP1/CIN85, CD2AP and ARHGEF7, where one CBLB peptide binds two copies of the other protein. Interacts with poly-ubiquitinated proteins. Dimerization is required for the binding of poly-ubiquitin, but not for the binding of mono-ubiquitin. Expressed in placenta, heart, lung, kidney, spleen, ovary and testis, as well as fetal brain and liver and hematopoietic cell lines, but not in adult brain, liver, pancreas, salivary gland, or skeletal muscle. Present in lymphocytes. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Ligase; Ubiquitin ligase; Calcium-binding; EC 6.3.2.-; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 3q13.11

Cellular Component: cytoplasm; cytosol; nucleoplasm; plasma membrane

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: NLS-bearing substrate import into nucleus; protein polyubiquitination; signal transduction

Research Articles on CBLB

Similar Products

Product Notes

The CBLB cblb (Catalog #AAA1267192) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaaact caatgaatgg cagaaaccct ggtggtcgag gaggaaatcc ccgaaaaggt cgaattttgg gtattattga tgctattcag gatgcagttg gaccccctaa gcaagctgcc gcagatcgca ggaccgtgga gaagacttgg aagctcatgg acaaagtggt aagactgtgc caaaatccca aacttcagtt gaaaaatagc ccaccatata tacttgatat tttgcctgat acatatcagc atttacgact tatattgagt aaatatgatg acaaccagaa acttgcccaa ctcagtgaga atgagtactt taaaatctac attgatagcc ttatgaaaaa gtcaaaacgg gcaataagac tctttaaaga aggcaaggag agaatgtatg aagaacagtc acaggacaga cgaaatctca caaaactgtc ccttatcttc agtcacatgc tggcagaaat caaagcaatc tttcccaatg gtcaattcca gggagataac tttcgtatca caaaagcaga tgctgctgaa ttctggagaa agttttttgg agacaaaact atcgtaccat ggaaagtatt cagacagtgc cttcatgagg tccaccagat tagctctggc ctggaagcaa tggctctaaa atcaacaatt gatttaactt gcaatgatta catttcagtt tttgaatttg atatttttac caggctgttt cagccttggg gctctatttt gcggaattgg aatttcttag ctgtgacaca tccaggttac atggcatttc tcacatatga tgaagttaaa gcacgactac agaaatatag caccaaaccc ggaagctata ttttccggtt aagttgcact cgattgggac agtgggccat tggctatgtg actggggatg ggaatatctt acagaccata cctcataaca agcccttatt tcaagccctg attgatggca gcagggaagg attttatctt tatcctgatg ggaggagtta taatcctgat ttaactggat tatgtgaacc tacacctcat gaccatataa aagttacaca ggaacaatat gaattatatt gtgaaatggg ctccactttt cagctctgta agatttgtgc agagaatgac aaagatgtca agattgagcc ttgtgggcat ttgatgtgca cctcttgcct tacggcatgg caggagtcgg atggtcaggg ctgccctttc tgtcgttgtg aaataaaagg aactgagccc ataatcgtgg atccctttga tccaagagat gaaggctcca ggtgttgcag catcattgac ccctttggca tgccgatgct cgacttggac gacgatgatg atcgtgagga gtccttgatg atgaatcggt tggcaaacgt ccgaaagtgc actgacaggc agaactcacc agtcacatca ccaggatcct ctccccttgc ccagagaaga aagccacagc ctgacccact ccagatccca catctaagcc tgccacccgt gcctcctcgc ctggatctaa ttcagaaagg catagttaga tctccctgtg gcagcccaac gggttcacca aagtcttctc cttgcatggt gagaaaacaa gataaaccac tcccagcacc acctcctccc ttaagagatc ctcctccacc gccacctgaa agacctccac caatcccacc agacaataga ctgagtagac acatccatca tgtggaaagc gtgccttcca aagacccgcc aatgcctctt gaagcatggt gccctcggga tgtgtttggg actaatcagc ttgtgggatg tcgactccta ggggagggct ctccaaaacc tggaatcaca gcgagttcaa atgtcaatgg aaggcacagt agagtgggct ctgacccagt gcttatgcgg aaacacagac gccatgattt gcctttagaa ggagctaagg tcttttccaa tggtcacctt ggaagtgaag aatatgatgt tcctccccgg ctttctcctc ctcctccagt taccaccctc ctccctagca taaagtgtac tggtccgtta gcaaattctc tttcagagaa aacaagagac ccagtagagg aagatgatga tgaatacaag attccttcat cccaccctgt ttccctgaat tcacaaccat ctcattgtca taatgtaaaa cctcctgttc ggtcttgtga taatggtcac tgtatgctga atggaacaca tggtccatct tcagagaaga aatcaaacat ccctgactta agcatatatt taaagggaga tgtttttgat tcagcctctg atcccgtgcc attaccacct gccaggcctc caactcggga caatccaaag catggttctt cactcaacag gacgccctct gattatgatc ttctcatccc tccattaggt gaagatgctt ttgatgccct ccctccatct ctcccacctc ccccacctcc tgcaaggcat agtctcattg aacattcaaa acctcctggc tccagtagcc ggccatcctc aggacaggat ctttttcttc ttccttcaga tccctttgtt gatctagcaa gtggccaagt tcctttgcct cccgctagaa ggttaccagg tgaaaatgtc aaaactaaca gaacatcaca ggactatgat cagcttcctt catgttcaga tggttcacag gcaccagcca gaccccctaa accacgaccg cgcaggactg caccagaaat tcaccacaga aaaccccatg ggcctgaggc ggcattggaa aatgtcgatg caaaaattgc aaaactcatg ggagagggtt atgcctttga agaggtgaag agagccttag agatagccca gaataatgtc gaagttgccc ggagcatcct ccgagaattt gccttccctc ctccagtatc cccacgtcta aatctatag. It is sometimes possible for the material contained within the vial of "CBLB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.