Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CBFA2T2 cdna clone

CBFA2T2 cDNA Clone

Gene Names
CBFA2T2; EHT; p85; MTGR1; ZMYND3
Synonyms
CBFA2T2; CBFA2T2 cDNA Clone; CBFA2T2 cdna clone
Ordering
For Research Use Only!
Sequence
atggggtttcaccatgttggccaggctcgtcttgaactcctgacctcaggtgatctgcctgcattggcctcccaacgtgctgggattacagttggtcctgagaaaagggtgccagcgatgcctggatcgcctgtggaagtgaagatacagtccagatcctcacctcccaccatgccacccctcccaccaataaatcctggaggaccgaggccagtgtccttcactcctactgcattaagcaatggcatcaaccattctcctcctaccctgaatggtgccccatcaccgccacagagattcagcaatggtcctgcctcctccacatcatctgcactcacaaatcagcaattgccagccacttgtggtgctcgacaactcagcaagttgaaacgctttcttaccactctgcaacagtttggcaatgacatctcccctgagattggggagaaggtgcggactcttgttcttgcactggtgaactcaacagtgacaattgaggaattccactgtaagctccaagaagccacaaactttccccttcgtccttttgtgattccatttctcaaggccaacctgcccctgctgcagcgggaactgctgcactgcgctcgggcggccaagcagaccccatcccagtacctggctcagcacgaacaccttctgctcaacacaagcattgcatcgcctgctgactcgtcagagttgctcatggaggtgcacggaaatgggaagaggcccagtccagagaggagagaagagaatagttttgatagagacacaattgctcctgagcctcctgccaagagagtatgtaccatcagccctgctcctcggcacagtcctgctctcactgtgcccctcatgaatcctgggggccaattccatcctacccctccacctcttcagcattacaccttagaggatattgcaacttctcacctgtatcgggaacccaacaagatgctagagcatcgagaagttcgtgatagacaccacagtcttggtctaaatggaggctatcaagatgagttggtagatcatcgtttgacagaaagggaatgggctgatgaatggaaacatcttgaccatgcgctgaattgcattatggaaatggtagagaaaacaaggcgctctatggcagttctgcggcgctgtcaggaatcagatcgtgaagaactcaactactggaaaagacggtacaatgaaaacacagagctgaggaaaacggggaccgagttggtctccaggcagcacagccctgggagtgcagattctctcagcaatgattctcagagagagttcaacagcaggccaggtacaggatacgtacctgtggagttttggaaaaaaacagaagaagctgtgaataaggtgaaaattcaggccatgtcagaagtacagaaggccgtcgctgaggcagagcagaaagcctttgaagtgattgcaacagagagagcacgaatggagcaaaccatagcggatgtcaagcggcaggccgcagaggatgctttcctcgtcatcaatgagcaagaggagtccacggagaactgctggaactgtggccgcaaagccagcgagacatgcagtggctgcaatatcgcgcgatactgtggctctttctgccagcacaaggactgggagcggcaccaccgcctctgtggtcagaacctgcatggccagagcccccacggccagggccggccgctgcttcctgtaggcaggggctcctctgccaggtccgccgactgcagcgtgcccagcccagccctcgacaagacctcggcaaccacatcgcgttcctcaacacctgcttctgtgacagctatcgacaccaacggactctga
Sequence Length
1845
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,878 Da
NCBI Official Full Name
Homo sapiens core-binding factor, runt domain, alpha subunit 2; translocated to, 2, mRNA
NCBI Official Synonym Full Names
CBFA2/RUNX1 translocation partner 2
NCBI Official Symbol
CBFA2T2
NCBI Official Synonym Symbols
EHT; p85; MTGR1; ZMYND3
NCBI Protein Information
protein CBFA2T2
UniProt Protein Name
Protein CBFA2T2
Protein Family
UniProt Gene Name
CBFA2T2
UniProt Synonym Gene Names
EHT; MTGR1
UniProt Entry Name
MTG8R_HUMAN

NCBI Description

In acute myeloid leukemia, especially in the M2 subtype, the t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities. The translocation produces a chimeric gene made up of the 5'-region of the RUNX1 (AML1) gene fused to the 3'-region of the CBFA2T1 (MTG8) gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. The protein encoded by this gene binds to the AML1-MTG8 complex and may be important in promoting leukemogenesis. Several transcript variants are thought to exist for this gene, but the full-length natures of only three have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

CBFA2T2: May function as a complex with the chimeric protein RUNX1/AML1-CBFA2T1/MTG8 which is produced in acute myeloid leukemia with the chromosomal translocation t(8;21). May thus be involved in the repression of AML1-dependent transcription and the induction of G-CSF/CSF3-dependent cell growth. May be a tumor suppressor gene candidate involved in myeloid tumors with the deletion of the 20q11 region. Belongs to the CBFA2T family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 20q11

Cellular Component: nucleus

Molecular Function: protein binding; transcription corepressor activity

Biological Process: negative regulation of transcription, DNA-dependent

Research Articles on CBFA2T2

Similar Products

Product Notes

The CBFA2T2 cbfa2t2 (Catalog #AAA1278092) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggtttc accatgttgg ccaggctcgt cttgaactcc tgacctcagg tgatctgcct gcattggcct cccaacgtgc tgggattaca gttggtcctg agaaaagggt gccagcgatg cctggatcgc ctgtggaagt gaagatacag tccagatcct cacctcccac catgccaccc ctcccaccaa taaatcctgg aggaccgagg ccagtgtcct tcactcctac tgcattaagc aatggcatca accattctcc tcctaccctg aatggtgccc catcaccgcc acagagattc agcaatggtc ctgcctcctc cacatcatct gcactcacaa atcagcaatt gccagccact tgtggtgctc gacaactcag caagttgaaa cgctttctta ccactctgca acagtttggc aatgacatct cccctgagat tggggagaag gtgcggactc ttgttcttgc actggtgaac tcaacagtga caattgagga attccactgt aagctccaag aagccacaaa ctttcccctt cgtccttttg tgattccatt tctcaaggcc aacctgcccc tgctgcagcg ggaactgctg cactgcgctc gggcggccaa gcagacccca tcccagtacc tggctcagca cgaacacctt ctgctcaaca caagcattgc atcgcctgct gactcgtcag agttgctcat ggaggtgcac ggaaatggga agaggcccag tccagagagg agagaagaga atagttttga tagagacaca attgctcctg agcctcctgc caagagagta tgtaccatca gccctgctcc tcggcacagt cctgctctca ctgtgcccct catgaatcct gggggccaat tccatcctac ccctccacct cttcagcatt acaccttaga ggatattgca acttctcacc tgtatcggga acccaacaag atgctagagc atcgagaagt tcgtgataga caccacagtc ttggtctaaa tggaggctat caagatgagt tggtagatca tcgtttgaca gaaagggaat gggctgatga atggaaacat cttgaccatg cgctgaattg cattatggaa atggtagaga aaacaaggcg ctctatggca gttctgcggc gctgtcagga atcagatcgt gaagaactca actactggaa aagacggtac aatgaaaaca cagagctgag gaaaacgggg accgagttgg tctccaggca gcacagccct gggagtgcag attctctcag caatgattct cagagagagt tcaacagcag gccaggtaca ggatacgtac ctgtggagtt ttggaaaaaa acagaagaag ctgtgaataa ggtgaaaatt caggccatgt cagaagtaca gaaggccgtc gctgaggcag agcagaaagc ctttgaagtg attgcaacag agagagcacg aatggagcaa accatagcgg atgtcaagcg gcaggccgca gaggatgctt tcctcgtcat caatgagcaa gaggagtcca cggagaactg ctggaactgt ggccgcaaag ccagcgagac atgcagtggc tgcaatatcg cgcgatactg tggctctttc tgccagcaca aggactggga gcggcaccac cgcctctgtg gtcagaacct gcatggccag agcccccacg gccagggccg gccgctgctt cctgtaggca ggggctcctc tgccaggtcc gccgactgca gcgtgcccag cccagccctc gacaagacct cggcaaccac atcgcgttcc tcaacacctg cttctgtgac agctatcgac accaacggac tctga. It is sometimes possible for the material contained within the vial of "CBFA2T2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.