Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CARTPT cdna clone

CARTPT cDNA Clone

Gene Names
CARTPT; CART
Synonyms
CARTPT; CARTPT cDNA Clone; CARTPT cdna clone
Ordering
For Research Use Only!
Sequence
atggagagctcccgcgtgaggctgctgcccctcctgggcgccgccctgctgctgatgctacctctgttgggtacccgtgcccaggaggacgccgagctccagccccgagccctggacatctactctgccgtggatgatgcctcccacgagaaggagctgatcgaagcgctgcaagaagtcttgaagaagctcaagagtaaacgtgttcccatctatgagaagaagtatggccaagtccccatgtgtgacgccggtgagcagtgtgcagtgaggaaaggggcaaggatcgggaagctgtgtgactgtccccgaggaacctcctgcaattccttcctcctgaagtgcttatga
Sequence Length
351
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,829 Da
NCBI Official Full Name
Homo sapiens CART prepropeptide, mRNA
NCBI Official Synonym Full Names
CART prepropeptide
NCBI Official Symbol
CARTPT
NCBI Official Synonym Symbols
CART
NCBI Protein Information
cocaine- and amphetamine-regulated transcript protein
UniProt Protein Name
Cocaine- and amphetamine-regulated transcript protein
UniProt Gene Name
CARTPT
UniProt Synonym Gene Names
CART
UniProt Entry Name
CART_HUMAN

NCBI Description

This gene encodes a preproprotein that is proteolytically processed to generate multiple biologically active peptides. These peptides play a role in appetite, energy balance, maintenance of body weight, reward and addiction, and the stress response. Expression of a similar gene transcript in rodents is upregulated following administration of cocaine and amphetamine. Mutations in this gene are associated with susceptibility to obesity in humans. [provided by RefSeq, Feb 2016]

Uniprot Description

CARTPT: Satiety factor closely associated with the actions of leptin and neuropeptide y; this anorectic peptide inhibits both normal and starvation-induced feeding and completely blocks the feeding response induced by neuropeptide Y and regulated by leptin in the hypothalamus. It promotes neuronal development and survival in vitro. Belongs to the CART family.

Protein type: Secreted; Motility/polarity/chemotaxis; Hormone; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 5q13.2

Cellular Component: extracellular space; secretory granule

Molecular Function: neuropeptide hormone activity; protein binding

Biological Process: activation of MAPKK activity; adult feeding behavior; cell glucose homeostasis; cell-cell signaling; cellular response to starvation; circadian regulation of gene expression; G-protein coupled receptor protein signaling pathway; negative regulation of appetite; negative regulation of bone resorption; negative regulation of osteoclast differentiation; neuropeptide signaling pathway; positive regulation of blood pressure; positive regulation of epinephrine secretion; positive regulation of transmission of nerve impulse; signal transduction

Disease: Obesity

Research Articles on CARTPT

Similar Products

Product Notes

The CARTPT cartpt (Catalog #AAA1269888) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagct cccgcgtgag gctgctgccc ctcctgggcg ccgccctgct gctgatgcta cctctgttgg gtacccgtgc ccaggaggac gccgagctcc agccccgagc cctggacatc tactctgccg tggatgatgc ctcccacgag aaggagctga tcgaagcgct gcaagaagtc ttgaagaagc tcaagagtaa acgtgttccc atctatgaga agaagtatgg ccaagtcccc atgtgtgacg ccggtgagca gtgtgcagtg aggaaagggg caaggatcgg gaagctgtgt gactgtcccc gaggaacctc ctgcaattcc ttcctcctga agtgcttatg a. It is sometimes possible for the material contained within the vial of "CARTPT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.