C3orf37 cdna clone

C3orf37 cDNA Clone

Gene Names

HMCES; DC12; SRAPD1; C3orf37

Synonyms

C3orf37; C3orf37 cDNA Clone; C3orf37 cdna clone

Ordering
Cat. Num. AAA1272660 For Research Use Only!

Sequence

atgtgtgggcgaacatcctgtcacttacctagagatgttctcacgagagcttgcgcctaccaggatcggcggggccagcagcggctcccggagtggagggaccctgataagtactgcccctcttacaacaagagtcctcaatccaacagcccagtgcttctgtctcgactgcactttgagaaggatgcagactcatctgagcgtatcattgctcccatgcgctggggcttggtcccttcttggttcaaagaaagtgatccttccaagctgcagttcaatactaccaactgtcgtagtgataccgtaatggagaaacggtcatttaaggtgcctctgggaaagggaagacgctgtgtcgttttagcagatggattctatgagtggcagcgatgtcagggaacaaaccagaggcagccatacttcatctattttcctcaaatcaagacagagaagtcaggtagcattggtgctgcagatagtcctgagaactgggagaaagtctgggacaactggaggctgctgacaatggccgggatctttgactgctgggagcccccagagggaggagatgtcctgtattcctataccatcatcacagtggattcctgcaaaggcttgagtgacatccaccacaggatgcctgccatattagatggagaggaggcagtttctaaatggcttgactttggtgaagtctcaactcaggaagctctgaaattaatccacccaacagagaacatcaccttccatgcagtctcttctgtggtgaacaactcgcgaaacaacactcctgagtgtctggctcctgtcgacttggtggtcaaaaaggagctcagggcaagtggcagtagccagaggatgttgcagtggttggccacaaagtcacccaaaaaggaagactcaaaaacacctcaaaaggaagagtcagatgttccccagtggtccagtcagttcctgcagaagagtccactccccaccaagagaggcactgcaggactcctagagcaatggctgaagcgggagaaggaggaggaacctgtggccaagcgtccttacagccagtga

Sequence Length

1065

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

33873294

NCBI GeneID

56941

Molecular Weight

40,575 Da

NCBI Official Full Name

Homo sapiens chromosome 3 open reading frame 37, mRNA

NCBI Official Synonym Full Names

5-hydroxymethylcytosine (hmC) binding, ES cell-specific

NCBI Official Symbol

HMCES

NCBI Official Synonym Symbols

DC12; SRAPD1; C3orf37

NCBI Protein Information

embryonic stem cell-specific 5-hydroxymethylcytosine-binding protein

UniProt Protein Name

Embryonic stem cell-specific 5-hydroxymethylcytosine-binding protein

UniProt Gene Name

HMCES

UniProt Synonym Gene Names

C3orf37; DC12; SRAPD1; ES cell-specific 5hmC-binding protein

UniProt Entry Name

HMCES_HUMAN

Uniprot Description

HMCES: Belongs to the UPF0361 family.

Protein type: EC 3.4.-.-

Chromosomal Location of Human Ortholog: 3q21.3

Research Articles on C3orf37

1. The findings of this study described in this study emphasise the importance of 5hmC in brain development and ageing and will help to better understand the complexity and plasticity of the brain.

Similar Products

Product Notes

The C3orf37 hmces (Catalog #AAA1272660) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtgggc gaacatcctg tcacttacct agagatgttc tcacgagagc ttgcgcctac caggatcggc ggggccagca gcggctcccg gagtggaggg accctgataa gtactgcccc tcttacaaca agagtcctca atccaacagc ccagtgcttc tgtctcgact gcactttgag aaggatgcag actcatctga gcgtatcatt gctcccatgc gctggggctt ggtcccttct tggttcaaag aaagtgatcc ttccaagctg cagttcaata ctaccaactg tcgtagtgat accgtaatgg agaaacggtc atttaaggtg cctctgggaa agggaagacg ctgtgtcgtt ttagcagatg gattctatga gtggcagcga tgtcagggaa caaaccagag gcagccatac ttcatctatt ttcctcaaat caagacagag aagtcaggta gcattggtgc tgcagatagt cctgagaact gggagaaagt ctgggacaac tggaggctgc tgacaatggc cgggatcttt gactgctggg agcccccaga gggaggagat gtcctgtatt cctataccat catcacagtg gattcctgca aaggcttgag tgacatccac cacaggatgc ctgccatatt agatggagag gaggcagttt ctaaatggct tgactttggt gaagtctcaa ctcaggaagc tctgaaatta atccacccaa cagagaacat caccttccat gcagtctctt ctgtggtgaa caactcgcga aacaacactc ctgagtgtct ggctcctgtc gacttggtgg tcaaaaagga gctcagggca agtggcagta gccagaggat gttgcagtgg ttggccacaa agtcacccaa aaaggaagac tcaaaaacac ctcaaaagga agagtcagat gttccccagt ggtccagtca gttcctgcag aagagtccac tccccaccaa gagaggcact gcaggactcc tagagcaatg gctgaagcgg gagaaggagg aggaacctgt ggccaagcgt ccttacagcc agtga. It is sometimes possible for the material contained within the vial of "C3orf37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

C3orf37 cdna clone