C3orf37 cdna clone
C3orf37 cDNA Clone
Gene Names
HMCES; DC12; SRAPD1; C3orf37
Synonyms
C3orf37; C3orf37 cDNA Clone; C3orf37 cdna clone
Sequence
atgtgtgggcgaacatcctgtcacttacctagagatgttctcacgagagcttgcgcctaccaggatcggcggggccagcagcggctcccggagtggagggaccctgataagtactgcccctcttacaacaagagtcctcaatccaacagcccagtgcttctgtctcgactgcactttgataaggatgcagactcatctgagcgtatcattgctcccatgcgctggggcttggtcccttcttggttcaaagaaagtgatccttccaagctgcagttcaatactaccaactgtcgtagtgataccgtaatggagaaacggtcatttaaggtgcctctgggaaagggaagacgctgtgtcgttttagcagatggattctatgagtggcagcgatgtcagggaacaaaccagaggcagccatacttcatctattttcctcaaatcaagacagagaagtcaggtagcattggtgctgcagatagtcctgagaactgggagaaagtctgggacaactggaggctgctgacaatggccgggatctttgactgctgggagcccccagagggaggagatgtcctgtattcctataccatcatcacagtggattcctgcaaaggcttgagtgacatccaccacaggatgcctgccatattagatggagaggaggcagtttctaaatggcttgactttggtgaagtctcaactcaggaagctctgaaattaatccacccaacagagaacatcaccttccatgcagtctcttctgtggtgaacaactcgcgaaacaacactcctgagtgtctggctcctgtcgacttggtggtcaaaaaggagctcagggcaagtggcagtagccagaggatgttgcagtggttggccacaaagtcacccaaaaaggaagactcaaaaacacctcaaaaggaagagtcagatgttccccagtggtccagtcagttcctgcagaagagtccactccccaccaagagaggcactgcaggactcctagagcaatggctgaagcgggagaaggaggaggaacctgtggccaagcgtccttacagccagtga
Sequence Length
1065
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
40,575 Da
NCBI Official Full Name
Homo sapiens chromosome 3 open reading frame 37, mRNA
NCBI Official Synonym Full Names
5-hydroxymethylcytosine (hmC) binding, ES cell-specific
NCBI Official Symbol
HMCES
NCBI Official Synonym Symbols
DC12; SRAPD1; C3orf37
NCBI Protein Information
embryonic stem cell-specific 5-hydroxymethylcytosine-binding protein
UniProt Protein Name
Embryonic stem cell-specific 5-hydroxymethylcytosine-binding protein
UniProt Gene Name
HMCES
UniProt Synonym Gene Names
C3orf37; DC12; SRAPD1; ES cell-specific 5hmC-binding protein
UniProt Entry Name
HMCES_HUMAN
Uniprot Description
HMCES: Belongs to the UPF0361 family.
Protein type: EC 3.4.-.-
Chromosomal Location of Human Ortholog: 3q21.3
Research Articles on C3orf37
Similar Products
Product Notes
The C3orf37 hmces (Catalog #AAA1268981) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtgggc gaacatcctg tcacttacct agagatgttc tcacgagagc ttgcgcctac caggatcggc ggggccagca gcggctcccg gagtggaggg accctgataa gtactgcccc tcttacaaca agagtcctca atccaacagc ccagtgcttc tgtctcgact gcactttgat aaggatgcag actcatctga gcgtatcatt gctcccatgc gctggggctt ggtcccttct tggttcaaag aaagtgatcc ttccaagctg cagttcaata ctaccaactg tcgtagtgat accgtaatgg agaaacggtc atttaaggtg cctctgggaa agggaagacg ctgtgtcgtt ttagcagatg gattctatga gtggcagcga tgtcagggaa caaaccagag gcagccatac ttcatctatt ttcctcaaat caagacagag aagtcaggta gcattggtgc tgcagatagt cctgagaact gggagaaagt ctgggacaac tggaggctgc tgacaatggc cgggatcttt gactgctggg agcccccaga gggaggagat gtcctgtatt cctataccat catcacagtg gattcctgca aaggcttgag tgacatccac cacaggatgc ctgccatatt agatggagag gaggcagttt ctaaatggct tgactttggt gaagtctcaa ctcaggaagc tctgaaatta atccacccaa cagagaacat caccttccat gcagtctctt ctgtggtgaa caactcgcga aacaacactc ctgagtgtct ggctcctgtc gacttggtgg tcaaaaagga gctcagggca agtggcagta gccagaggat gttgcagtgg ttggccacaa agtcacccaa aaaggaagac tcaaaaacac ctcaaaagga agagtcagat gttccccagt ggtccagtca gttcctgcag aagagtccac tccccaccaa gagaggcact gcaggactcc tagagcaatg gctgaagcgg gagaaggagg aggaacctgt ggccaagcgt ccttacagcc agtga. It is sometimes possible for the material contained within the vial of "C3orf37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
